1FG0: Large Ribosomal Subunit Complexed With A 13 Bp Minihelix- Puromycin Compound

PDB ID: 1FG0Download
MMDB ID: 49066
PDB Deposition Date: 2000/7/26
Updated in MMDB: 2007/10
Experimental Method:
x-ray diffraction
Resolution: 3  Å
Source Organism:
synthetic construct
Biological Unit for 1FG0: dimeric; determined by author
Molecular Components in 1FG0
Label Count Molecule
Nucleotides(2 molecules)
1
23S Ribosomal RNA
Molecule annotation
1
5'-r(ccggcgggcugguucaaaccggcccgccggacc)-3'-5'- R(p-puromycin)-3'
Molecule annotation
* Click molecule labels to explore molecular sequence information.

Citing MMDB
.