1DJD: The Solution Structure Of A Non-Bay Region 11r- Benz[a]anthracene Oxide Adduct At The N6 Position Of Adenine Of An Oligodeoxynucleotide Containing The Human N- Ras Codon 61 Sequence

PDB ID: 1DJDDownload
MMDB ID: 48665
PDB Deposition Date: 1999/12/2
Updated in MMDB: 2007/10
Experimental Method:
nmr
Molecular Components in 1DJD
Label Count Molecule
Nucleotides(2 molecules)
1
DNA(5'-d(ctgtgtatctatatgtatatg)-3')
Molecule annotation
1
DNA(5'-d(ctttttctttttgtttctctg)-3')
Molecule annotation
Chemical (1 molecule)
1
1
* Click molecule labels to explore molecular sequence information.

Citing MMDB
.