NCBI CCDS banner
PubMed Entrez Gene BLAST OMIM
  

CCDS
Home
FTP
Process
Releases & Statistics

Collaborators
EBI
HGNC
MGI
NCBI

Contact Us
email CCDS

Genome Displays

Ensembl
NCBI
UCSC
VEGA

Related Resources
Gene
HomoloGene
MANE
RefSeq


Report for CCDS46424.1 (current version)

CCDS Status Species Chrom. Gene CCDS Release NCBI Annotation Release Ensembl Annotation Release Links
46424.1 Public Homo sapiens 2 NEB 24 110 108 CCDS HistoryNCBI Gene:4703Re-query CCDS DB by CCDS ID:46424.1Re-query CCDS DB by GeneID:4703See the combined annotation on chromosome 2 in Sequence Viewer

Public since: CCDS release 6, NCBI annotation release 37.1, Ensembl annotation release 55

Review status: Reviewed (by RefSeq and Havana)

Sequence IDs included in CCDS 46424.1

Original Current Source Nucleotide ID Protein ID MANE Status in CCDS Seq. Status Links
Original member Current member EBI ENST00000409198.5 ENSP00000386259.1 Accepted alive Link to Ensembl Transcript Viewer:ENST00000409198.5Link to Ensembl Protein Viewer:ENSP00000386259.1Re-query CCDS DB by Nucleotide ID:ENST00000409198Re-query CCDS DB by Protein ID:ENSP00000386259
Original member Current member NCBI NM_004543.5 NP_004534.3 Accepted alive Link to Nucleotide Sequence:NM_004543.5Link to Protein Sequence:NP_004534.3Re-query CCDS DB by Nucleotide ID:NM_004543Re-query CCDS DB by Protein ID:NP_004534Link to BLAST:NP_004534.3

RefSeq Length Related UniProtKB/SwissProt Length Identity Gaps Mismatches
NP_004534.3 6669 P20929-4 6669 100% 0 0

Chromosomal Locations for CCDS 46424.1

Assembly GRCh38.p14 (GCF_000001405.40)

On '-' strand of Chromosome 2 (NC_000002.12)
Genome Browser links: Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2See the combined annotation on chromosome 2 in Sequence Viewer

Chromosome Start Stop Links
2 151485760 151485933 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151489971 151490077 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151490372 151490518 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151491683 151491775 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151492098 151492281 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151492387 151492494 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151493353 151493445 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151493775 151493867 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151494161 151494253 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151496276 151496368 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151502793 151502885 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151503349 151503441 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151505478 151505570 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151506166 151506258 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151506909 151507013 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151508005 151508109 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151512733 151512837 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151513580 151513693 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151514318 151514428 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151514818 151514928 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151516459 151516563 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151518318 151518422 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151518965 151519069 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151519658 151519768 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151524311 151524415 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151524515 151524616 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151525163 151525273 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151525958 151526068 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151526158 151526262 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151526918 151527022 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151527481 151527585 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151529210 151529314 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151530994 151531101 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151531792 151531896 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151534215 151534319 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151535691 151535795 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151537132 151537236 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151537872 151537976 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151538140 151538244 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151540344 151540448 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151540697 151540801 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151541447 151541551 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151545888 151545998 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151546345 151546443 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151547429 151547533 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151547634 151547738 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151548308 151548415 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151549636 151549740 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151551738 151551845 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151552672 151552776 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151553398 151553502 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151553828 151554025 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151554931 151555044 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151560592 151560699 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151561004 151561108 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151561208 151561312 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151562110 151562214 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151562611 151562808 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151563606 151563719 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151563823 151563930 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151565044 151565148 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151565501 151565605 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151565716 151565820 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151567168 151567479 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151568071 151568178 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151568316 151568417 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151568618 151568716 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151569268 151569372 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151570081 151570392 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151570497 151570601 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151575695 151575799 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151576151 151576354 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151609809 151610120 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151610516 151610623 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151610762 151610866 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151612186 151612389 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151614276 151614587 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151616002 151616109 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151617364 151617468 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151618275 151618478 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151619451 151619762 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151620919 151621026 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151625534 151625638 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151627002 151627205 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151627523 151627834 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151629539 151629646 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151630715 151630819 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151631143 151631178 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151639893 151640060 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151640355 151640666 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151642574 151642681 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151642765 151642869 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151643150 151643353 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151643818 151644129 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151644468 151644575 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151646130 151646234 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151650176 151650379 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151650574 151650885 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151653992 151654099 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151655270 151655374 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151655817 151656023 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151656153 151656464 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151657983 151658090 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151659065 151659169 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151662135 151662341 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151663548 151663859 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151664501 151664608 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151664759 151664863 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151665333 151665539 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151666090 151666401 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151667804 151667911 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151669027 151669131 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151671023 151671229 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151672369 151672680 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151674477 151674584 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151675287 151675391 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151677565 151677771 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151677876 151678187 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151679721 151679828 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151679918 151680022 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151680730 151680828 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151682662 151682769 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151684778 151684975 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151687419 151687532 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151687626 151687733 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151688292 151688396 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151690727 151690825 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151691864 151691968 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151692059 151692166 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151692261 151692362 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151694323 151694436 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151694522 151694629 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151695578 151695682 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151696637 151696735 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151697148 151697252 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151697350 151697457 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151697544 151697648 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151706881 151706997 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151709656 151709763 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151710434 151710538 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151717416 151717520 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151723382 151723486 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151724260 151724364 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151724857 151724961 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151725453 151725560 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151727691 151727906 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151729615 151729656 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 151733121 151733156 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2

CCDS Sequence Data
Blue highlighting indicates alternating exons.
Red highlighting indicates amino acids encoded across a splice junction.
 
Mouse over the nucleotide or protein sequence below and click on the highlighted codon or residue to select the pair.

Nucleotide Sequence (20010 nt):
ATGGCAGATGACGAAGACTATGAGGAGGTGGTGGAGTACTACACAGAAGAAGTGGTTTACGAAGAGGTGC
CG
GGAGAGACAATAACAAAAATTTATGAGACTACGACAACAAGGACATCTGACTATGAGCAATCAGAAAC
T
TCCAAACCAGCTCTGGCACAGCCAGCACTGGCACAGCCAGCATCAGCAAAGCCGGTGGAGAGGAGGAAG
GTC
ATCCGGAAGAAAGTGGATCCTTCAAAGTTCATGACCCCCTACATTGCACACAGTCAGAAAATGCAGG
AT
CTTTTTAGCCCAAATAAATACAAGGAGAAGTTTGAGAAAACAAAAGGACAGCCATACGCCAGCACAAC
A
GATACTCCAGAACTTCGCAGAATCAAAAAAGTACAAGATCAACTCAGTGAGGTTAAGTATCGAATGGAT
GGT
GATGTTGCTAAGACTATATGTCACGTAGATGAAAAAGCAAAGGATATTGAACATGCAAAGAAAGTGT
CG
CAGCAAGTCAGTAAGGTTTTATACAAGCAGAACTGGGAAGACACCAAGGATAAGTACCTGCTTCCTCC
T
GATGCCCCTGAACTTGTCCAGGCCGTTAAGAACACCGCCATGTTCAGCAAGAAACTGTACACTGAAGAC
TGG
GAAGCAGACAAAAGTTTGTTTTACCCCTATAATGATAGCCCGGAACTGAGGAGAGTTGCCCAGGCCC
AG
AAAGCTCTCAGTGATGTTGCCTACAAAAAAGGTCTCGCTGAACAGCAAGCTCAATTCACGCCTCTGGC
T
GATCCTCCAGATATAGAATTTGCCAAGAAAGTAACCAATCAAGTGAGCAAGCAAAAATACAAAGAAGAC
TAT
GAAAATAAAATCAAAGGCAAATGGAGTGAGACACCTTGCTTTGAAGTTGCAAATGCCAGAATGAATG
CT
GATAACATTAGCACAAGGAAATACCAGGAAGATTTTGAAAACATGAAAGACCAGATCTACTTCATGCA
G
ACCGAAACACCAGAGTATAAAATGAATAAAAAAGCTGGTGTGGCAGCTAGCAAGGTAAAATACAAAGAA
GAC
TATGAAAAGAATAAAGGAAAAGCAGATTATAATGTGCTTCCTGCTTCAGAGAACCCACAGCTTAGGC
AG
CTGAAGGCAGCAGGAGATGCCCTAAGTGACAAACTATACAAGGAAAACTATGAAAAGACAAAAGCAAA
G
AGCATAAATTACTGCGAGACCCCCAAATTCAAGCTCGATACTGTTCTGCAGAACTTCAGTAGTGATAAA
AAA
TATAAAGATTCCTACTTAAAAGATATTTTGGGACATTATGTAGGCAGCTTCGAGGATCCATACCATT
CA
CACTGCATGAAAGTCACAGCTCAAAACAGTGATAAAAACTACAAAGCAGAATACGAAGAAGACAGAGG
C
AAAGGCTTCTTCCCTCAGACCATAACTCAAGAATATGAAGCAATTAAGAAACTAGATCAGTGTAAAGAC
CAC
ACCTACAAAGTCCATCCAGATAAGACAAAATTCACCCAAGTTACAGACTCTCCTGTTCTGCTACAAG
CC
CAAGTCAATTCCAAACAACTGAGTGACTTAAATTACAAAGCAAAACATGAAAGTGAAAAGTTCAAGTG
C
CATATCCCCCCTGATACTCCTGCTTTTATCCAGCACAAAGTCAATGCCTATAACTTGAGTGATAATCTT
TAT
AAGCAAGACTGGGAGAAGAGCAAAGCCAAAAAGTTTGACATTAAAGTGGATGCCATTCCCCTGCTGG
CA
GCCAAAGCCAACACCAAGAACACCAGCGATGTGATGTACAAGAAAGACTATGAAAAAAACAAAGGGAA
A
ATGATTGGAGTCCTCAGCATTAATGACGATCCCAAGATGCTGCACTCCTTGAAGGTGGCCAAAAACCAG
AGT
GATAGATTATACAAGGAAAACTATGAGAAGACAAAGGCAAAGAGTATGAATTACTGTGAGACCCCAA
AA
TATCAACTTGATACTCAGCTGAAGAACTTCAGTGAGGCTAGATATAAAGACTTATATGTAAAGGATGT
T
TTGGGACATTATGTAGGCAGCATGGAGGACCCATATCACACACACTGCATGAAAGTTGCAGCTCAAAAC
AGT
GATAAAAGTTACAAAGCAGAATATGAAGAAGATAAAGGAAAATGCTATTTCCCTCAGACAATAACAC
AA
GAATATGAAGCAATCAAGAAGCTGGACCAGTGTAAAGATCATACCTACAAAGTTCATCCAGATAAGAC
C
AAATTCACGGCAGTCACTGATTCTCCTGTACTGTTGCAAGCCCAGCTCAACACGAAACAGCTTAGTGAT
CTG
AATTACAAAGCAAAACATGAAGGTGAGAAGTTCAAGTGCCATATACCAGCAGATGCTCCACAGTTTA
TC
CAACACAGAGTCAATGCCTATAATCTGAGTGATAATGTTTATAAGCAAGACTGGGAGAAGAGCAAAGC
C
AAGAAGTTTGACATTAAAGTGGACGCCATTCCCCTGTTGGCAGCCAAAGCCAACACCAAGAACACCAGC
GAT
GTGATGTACAAGAAAGACTATGAAAAGAGCAAAGGGAAAATGATTGGAGCCCTCAGCATTAATGACG
AT
CCAAAGATGCTGCACTCCTTGAAGACAGCCAAAAACCAGAGTGATCGCGAATATCGAAAAGATTATGA
A
AAGTCAAAAACTATCTACACGGCACCTCTTGATATGCTCCAAGTCACTCAAGCTAAGAAATCTCAGGCA
ATT
GCCAGCGACGTTGATTATAAGCACATCTTACACAGTTACAGCTACCCCCCTGATAGCATCAATGTGG
AC
CTTGCCAAGAAGGCATATGCGCTGCAGAGCGATGTTGAATACAAAGCTGACTACAATAGCTGGATGAA
A
GGTTGTGGCTGGGTGCCTTTTGGGTCCTTAGAAATGGAAAAGGCAAAGCGAGCTTCAGACATCCTCAAT
GAG
AAAAAATATCGCCAACATCCAGACACCCTCAAGTTTACCTCGATTGAAGATGCTCCAATTACAGTAC
AG
TCTAAAATTAACCAGGCCCAGAGGAGTGATATCGCTTACAAAGCCAAAGGAGAGGAAATTATTCACAA
A
TACAACCTGCCACCAGACCTGCCCCAGTTCATCCAGGCTAAAGTTAATGCCTACAATATCAGTGAGAAT
ATG
TACAAAGCAGACTTGAAAGACTTGAGCAAGAAGGGATATGACCTGAGAACTGATGCGATTCCCATCA
GA
GCTGCCAAAGCTGCCAGGCAGGCGGCGAGTGACGTTCAGTACAAAAAAGACTATGAAAAGGCTAAAGG
G
AAAATGGTTGGCTTCCAAAGTCTTCAAGATGACCCTAAACTGGTTCATTATATGAACGTGGCCAAGATA
CAA
TCAGATCGGGAGTATAAAAAAGACTATGAGAAGACAAAGTCCAAATACAACACGCCCCATGATATGT
TC
AATGTCGTGGCGGCTAAGAAAGCCCAGGATGTGGTCAGCAATGTCAACTATAAGCATTCTCTCCATCA
T
TACACCTACTTGCCTGACGCCATGGACCTGGAGCTGTCTAAGAACATGATGCAGATACAGAGTGATAAC
GTC
TACAAGGAAGACTACAACAACTGGATGAAAGGCATTGGCTGGATTCCTATTGGCAGTCTCGACGTCG
AA
AAAGTTAAAAAGGCCGGTGATGCTCTGAATGAAAAGAAGTACAGGCAACATCCAGACACCCTCAAATT
T
ACCAGCATTGTGGACTCCCCAGTTATGGTCCAGGCAAAACAGAACACGAAGCAAGTCAGTGATATCTTA
TAC
AAGGCTAAAGGAGAAGATGTGAAACATAAATACACCATGAGTCCTGATCTTCCTCAGTTTCTCCAGG
CC
AAGTGCAATGCTTACAATATAAGTGACGTCTGTTATAAACGGGATTGGTATGACTTAATAGCCAAGGG
C
AACAATGTGCTGGGCGATGCTATTCCCATCACTGCAGCCAAGGCATCGAGAAACATTGCCAGTGATTAT
AAA
TACAAGGAAGCTTATGAGAAGTCAAAGGGAAAGCATGTGGGTTTCAGAAGCCTCCAGGATGATCCCA
AG
CTGGTCCACTATATGAATGTGGCAAAGCTGCAGTCTGATCGTGAATACAAGAAGAACTATGAGAACAC
C
AAAACCAGCTACCATACCCCTGGGGACATGGTTAGCATCACAGCTGCAAAGATGGCCCAGGATGTCGCT
ACC
AATGTCAACTACAAACAGCCATTGCATCATTACACATACCTACCTGACGCCATGAGTCTTGAGCATA
CG
AGGAATGTCAATCAAATTCAGAGTGATAATGTGTATAAAGACGAGTATAACAGCTTCTTGAAGGGCAT
C
GGATGGATCCCTATTGGTTCCCTGGAGGTGGAGAAGGTCAAGAAAGCAGGCGATGCATTAAATGAGAGG
AAG
TATCGACAGCACCCAGATACCGTCAAGTTCACAAGTGTGCCTGATTCCATGGGCATGGTGTTGGCTC
AG
CATAACACAAAGCAGCTAAGTGATTTGAACTACAAGGTAGAGGGAGAGAAACTGAAGCACAAGTATAC
T
ATTGACCCTGAATTGCCTCAGTTTATTCAAGCCAAAGTCAACGCCCTCAACATGAGTGATGCTCATTAT
AAA
GCAGATTGGAAGAAAACCATTGCCAAGGGCTATGATTTGAGACCAGATGCCATCCCAATTGTTGCTG
CA
AAAAGTTCAAGGAATATTGCTAGTGATTGCAAATATAAGGAGGCCTACGAGAAAGCCAAAGGCAAGCA
A
GTTGGATTTCTCAGTCTTCAGGATGATCCTAAACTGGTTCACTACATGAATGTGGCCAAAATCCAGTCT
GAT
CGTGAGTACAAAAAGGGCTATGAAGCCAGCAAGACCAAGTACCACACACCTCTGGATATGGTCAGTG
TG
ACAGCTGCAAAGAAATCTCAGGAGGTTGCCACCAACGCCAACTACAGACAGTCATACCACCACTACAC
T
CTCCTGCCCGATGCCTTGAATGTGGAGCACTCCAGGAATGCCATGCAGATTCAGAGTGATAATCTGTAC
AAA
TCTGACTTCACCAATTGGATGAAAGGGATCGGCTGGGTGCCCATAGAGTCCCTGGAGGTGGAGAAGG
CA
AAGAAAGCAGGAGAGATTCTTAGTGAGAAGAAGTATCGCCAGCACCCCGAGAAGCTGAAGTTCACTTA
C
GCCATGGACACAATGGAACAGGCACTTAACAAGAGTAACAAACTGAACATGGACAAGAGGCTCTACACT
GAA
AAATGGAACAAGGACAAGACCACCATTCATGTCATGCCTGACACACCGGATATTTTACTCTCCAGAG
TA
AACCAAATCACCATGAGTGATAAACTGTACAAAGCTGGCTGGGAAGAGGAAAAGAAGAAAGGATATGA
C
CTGAGGCCTGATGCCATTGCAATAAAGGCTGCAAGAGCCTCTAGAGACATTGCCAGTGATTACAAATAC
AAG
AAAGCCTATGAACAAGCCAAAGGGAAACACATTGGCTTCCGGAGCCTGGAAGATGACCCCAAGCTGG
TG
CACTTCATGCAAGTGGCCAAGATGCAGTCAGACCGGGAATACAAGAAGGGATATGAGAAATCCAAGAC
C
TCCTTCCACACCCCGGTGGACATGCTCAGTGTGGTGGCAGCCAAGAAGTCTCAGGAAGTGGCCACCAAT
GCC
AACTACAGGAACGTGATCCATACCTACAACATGCTTCCTGATGCCATGAGCTTTGAATTGGCCAAAA
AT
ATGATGCAGATTCAAAGTGATAATCAGTACAAGGCTGACTATGCTGACTTCATGAAGGGCATTGGATG
G
CTCCCTCTGGGCTCCCTGGAAGCAGAGAAAAACAAGAAAGCCATGGAGATTATTAGTGAAAAGAAGTAC
CGC
CAGCACCCAGACACTTTGAAGTATTCCACACTCATGGACTCGATGAACATGGTTTTGGCCCAGAATA
AT
GCAAAAATTATGAACGAACATCTCTACAAACAAGCATGGGAGGCTGACAAAACCAAAGTCCACATCAT
G
CCTGATATCCCCCAGATTATTTTGGCAAAGGCAAATGCAATTAATATGAGTGATAAACTCTACAAACTT
TCC
TTGGAAGAGTCTAAAAAGAAAGGCTATGATCTCAGACCTGATGCAATTCCTATCAAAGCTGCCAAGG
CT
TCCAGAGATATTGCAAGTGATTATAAATACAAGTACAATTATGAAAAAGGGAAGGGGAAAATGGTTGG
T
TTCCGCAGTCTCGAGGATGATCCCAAATTAGTCCATTCCATGCAAGTGGCTAAGATGCAATCTGATCGG
GAG
TACAAGAAAAACTATGAGAACACAAAGACCAGCTACCACACCCCTGCCGACATGCTCAGTGTCACGG
CT
GCAAAGGATGCCCAAGCCAACATCACCAACACTAACTACAAGCACCTGATTCACAAGTACATCCTCCT
T
CCAGATGCAATGAACATTGAGCTGACCAGGAATATGAATCGCATACAGAGTGATAATGAATATAAGCAA
GAT
TACAATGAATGGTACAAAGGGCTTGGCTGGAGTCCAGCAGGTTCTCTGGAAGTGGAGAAGGCCAAGA
AA
GCAACTGAATATGCCAGTGATCAGAAATACCGCCAGCACCCGAGCAACTTCCAGTTTAAGAAGCTGAC
T
GATTCCATGGACATGGTGCTTGCCAAGCAGAATGCACATACCATGAACAAGCATTTATACACCATTGAT
TGG
AATAAAGATAAGACCAAGATTCATGTGATGCCTGATACACCAGATATTTTACAAGCCAAGCAGAATC
AA
ACACTGTATAGTCAGAAACTCTATAAACTTGGATGGGAAGAAGCTTTGAAGAAAGGCTATGATCTCCC
A
GTTGATGCAATTTCTGTACAGCTAGCTAAAGCTTCAAGAGACATTGCTAGTGATTATAAATACAAACAA
GGC
TACCGAAAGCAACTTGGCCACCATGTTGGATTCCGGAGTCTGCAAGATGACCCAAAACTTGTGTTGT
CC
ATGAATGTAGCCAAAATGCAGAGTGAAAGAGAATACAAGAAGGACTTTGAGAAGTGGAAAACTAAGTT
C
TCCAGCCCAGTGGACATGTTGGGAGTGGTACTGGCCAAGAAGTGTCAGGAGTTGGTTAGTGACGTGGAC
TAC
AAGAACTACCTGCATCAGTGGACATGTCTGCCTGATCAGAACGATGTTGTGCAAGCTAAGAAAGTTT
AT
GAACTGCAAAGTGAGAATCTATATAAATCTGACCTTGAGTGGCTGAGAGGCATAGGATGGAGTCCCTT
G
GGTTCTTTAGAGGCAGAAAAGAACAAGCGGGCTTCGGAAATCATCAGTGAGAAGAAATATCGTCAGCCT
CCA
GACAGAAACAAGTTCACCAGCATTCCTGATGCCATGGATATAGTTCTGGCAAAGACAAATGCCAAAA
AT
AGGAGTGATAGACTTTATAGAGAAGCTTGGGACAAAGACAAGACTCAGATCCACATCATGCCTGATAC
A
CCTGACATTGTTCTGGCTAAAGCAAACTTAATCAACACAAGTGATAAACTCTACCGAATGGGTTATGAG
GAG
CTGAAGAGAAAAGGTTACGATCTTCCTGTTGATGCCATACCAATCAAAGCAGCAAAAGCCTCCCGGG
AA
ATTGCCAGTGAATACAAGTACAAGGAAGGCTTTCGCAAGCAGCTCGGCCACCACATTGGTGCCCGGAA
C
ATTGAAGATGACCCCAAGATGATGTGGTCCATGCATGTGGCCAAGATCCAGAGTGACAGGGAGTACAAG
AAG
GACTTTGAGAAGTGGAAGACCAAGTTCAGCAGCCCAGTGGACATGCTGGGGGTGGTGTTGGCCAAGA
AG
TGCCAGACCTTAGTCAGCGACGTGGACTACAAGAACTACCTGCACCAGTGGACATGCCTGCCCGACCA
G
AGCGATGTCATCCATGCTCGGCAGGCCTATGACCTCCAGAGCGATAATTTGTACAAGTCAGACCTTCAG
TGG
CTAAAAGGCATTGGCTGGATGACTAGTGGTTCTCTCGAGGATGAGAAAAATAAACGAGCCACCCAGA
TT
TTGAGTGACCATGTTTACCGTCAGCACCCAGATCAATTTAAGTTTTCCAGCCTTATGGATTCCATACC
A
ATGGTTTTGGCAAAAAACAATGCTATTACCATGAATCATCGCCTCTATACAGAAGCTTGGGATAAAGAT
AAA
ACCACTGTCCACATTATGCCAGATACCCCTGAAGTTTTATTAGCTAAACAAAACAAAGTAAATTACA
GT
GAGAAATTGTATAAGCTTGGCCTAGAAGAAGCCAAGAGGAAAGGTTATGACATGCGGGTAGATGCCAT
T
CCTATCAAGGCAGCCAAGGCCTCCAGAGATATTGCAAGTGAATTCAAGTACAAAGAAGGCTATCGTAAG
CAG
CTCGGCCACCACATTGGTGCCCGAGCTATACGTGATGACCCCAAGATGATGTGGTCCATGCACGTGG
CC
AAGATCCAGAGTGACAGGGAGTACAAGAAGGACTTTGAGAAGTGGAAGACCAAGTTCAGCAGCCCAGT
G
GACATGCTGGGGGTGGTGCTGGCCAAGAAGTGCCAGACCTTAGTCAGCGATGTGGACTACAAGAACTAC
CTG
CACCAGTGGACATGCCTGCCCGACCAGAGCGACGTCATCCATGCTCGGCAGGCCTATGACCTCCAGA
GC
GATAATATGTACAAGTCTGATCTCCAGTGGATGAGAGGCATTGGCTGGGTGTCCATTGGCTCTTTGGA
T
GTGGAAAAATGCAAAAGGGCAACTGAAATTTTGAGTGATAAAATCTATCGCCAGCCTCCAGACAGATTC
AAA
TTTACCAGTGTGACTGACTCTCTGGAACAAGTGCTGGCCAAGAACAATGCTCTCAACATGAATAAGC
GT
TTATACACAGAGGCCTGGGACAAAGACAAGACTCAAATTCACATAATGCCTGATACACCAGAGATTAT
G
TTGGCAAGGCAGAACAAAATCAACTACAGTGAGACTCTATACAAACTTGCCAATGAAGAAGCAAAAAAG
AAA
GGCTACGACTTGCGAAGTGACGCCATCCCCATCGTGGCTGCCAAGGCCTCCAGGGACGTTATCAGTG
AT
TACAAATACAAAGATGGTTACCGCAAGCAGCTCGGCCACCACATTGGAGCCCGGAACATTGAAGATGA
C
CCCAAGATGATGTGGTCCATGCATGTGGCCAAGATCCAGAGTGACAGGGAGTATAAGAAGGACTTTGAG
AAG
TGGAAGACCAAGTTCAGCAGCCCAGTGGACATGCTGGGAGTGGTGTTAGCCAAGAAGTGCCAGACCT
TA
GTCAGCGATGTGGACTACAAGAACTACCTGCACGAGTGGACGTGCCTGCCCGACCAGAATGATGTCAT
C
CATGCTCGGCAGGCCTATGACCTCCAGAGCGATAACATTTACAAATCTGATCTCCAGTGGCTGAGAGGC
ATT
GGCTGGGTCCCCATTGGGTCTATGGATGTGGTCAAGTGCAAGAGAGCTGCTGAAATACTGAGTGATA
AC
ATCTACCGCCAGCCTCCGGACAAGCTGAAATTTACCAGTGTGACTGACTCTCTAGAGCAGGTGCTGGC
C
AAGAACAATGCTCTCAATATGAACAAGCGCTTATACACAGAAGCCTGGGACAAAGACAAGACCCAAGTC
CAT
ATTATGCCTGATACACCTGAAATCATGTTGGCAAGACAAAATAAAATAAATTATAGTGAGAGCCTCT
AT
CGTCAGGCCATGGAAGAAGCCAAGAAAGAAGGCTATGACTTGAGAAGTGATGCCATTCCCATTGTGGC
T
GCCAAGGCCTCTCGGGATATTGCCAGTGATTACAAATACAAAGAAGCATATCGTAAACAGTTGGGTCAC
CAC
ATTGGCGCCCGAGCAGTACACGATGACCCCAAGATAATGTGGTCCCTCCACATTGCCAAAGTGCAGA
GT
GACCGTGAGTACAAGAAAGATTTTGAGAAATACAAGACAAGGTACAGCAGCCCAGTGGACATGCTTGG
T
ATCGTTTTGGCCAAGAAGTGTCAGACCTTGGTCAGCGATGTGGACTATAAACATCCTCTGCATGAATGG
ATC
TGCCTGCCCGACCAGAATGACATCATTCATGCACGGAAAGCCTATGACCTCCAGAGTGACAATTTGT
AT
AAGTCAGACCTTGAATGGATGAAAGGCATTGGCTGGGTTCCGATTGATTCCTTGGAAGTTGTTAGGGC
C
AAGAGAGCTGGAGAATTACTTAGTGATACTATCTACCGTCAGCGTCCAGAAACGCTGAAATTTACCAGT
ATA
ACGGACACTCCGGAGCAGGTGCTGGCAAAAAACAATGCTTTAAACATGAATAAGCGCTTATATACTG
AA
GCCTGGGACAATGACAAGAAAACTATTCATGTCATGCCTGATACACCAGAAATCATGTTAGCCAAACT
C
AACCGAATAAACTACAGTGATAAACTCTATAAACTTGCTTTGGAAGAGTCCAAGAAGGAAGGCTATGAC
TTG
CGTCTGGATGCCATTCCAATCCAAGCAGCCAAGGCTTCAAGAGATATTGCTAGTGATTACAAGTACA
AG
GAAGGCTACCGCAAACAGCTTGGCCACCATATTGGGGCCCGGAACATTAAGGATGACCCGAAGATGAT
G
TGGTCCATCCATGTGGCCAAGATCCAGAGTGACAGGGAGTACAAGAAGGAGTTTGAGAAGTGGAAGACC
AAG
TTCAGCAGCCCAGTGGACATGCTGGGGGTGGTGCTGGCCAAGAAGTGTCAGATCCTTGTAAGCGACA
TA
GACTACAAGCATCCCCTGCATGAATGGACCTGCCTGCCTGATCAGAATGACGTCATTCAGGCTCGGAA
G
GCCTATGACCTGCAGAGTGATGCTATTTACAAATCTGATCTTGAGTGGCTGAGAGGCATAGGATGGGTT
CCC
ATTGGCTCTGTAGAGGTCGAGAAAGTGAAGAGAGCTGGAGAAATCCTGAGTGACAGGAAGTATCGCC
AG
CCTGCAGACCAGCTCAAATTCACATGCATTACCGACACTCCGGAAATTGTCCTAGCAAAGAATAATGC
C
CTGACAATGAGCAAGCATTTATACACAGAAGCTTGGGATGCTGACAAAACCTCCATCCACGTGATGCCA
GAC
ACCCCAGATATCCTGCTGGCCAAGAGTAATTCTGCCAATATCAGCCAAAAACTTTACACCAAGGGAT
GG
GATGAATCAAAGATGAAGGACTATGATCTGAGAGCAGATGCTATTTCCATCAAAAGTGCCAAGGCCTC
C
AGGGACATCGCCAGTGACTACAAATACAAGGAAGCCTATGAGAAACAGAAAGGCCACCACATTGGAGCC
CAG
AGCATTGAAGATGATCCCAAGATTATGTGTGCCATACATGCAGGAAAAATTCAAAGTGAAAGGGAGT
AC
AAGAAGGAATTCCAAAAGTGGAAAACCAAGTTCTCTAGCCCAGTGGACATGTTAAGCATCTTGCTGGC
C
AAGAAATGTCAGACTTTGGTCACTGACATTGATTATCGCAATTACCTGCATGAATGGACATGCATGCCG
GAT
CAAAACGACATTATCCAAGCAAAAAAGGCCTATGACCTGCAGAGTGATGCCCTCTACAAGGCTGACT
TG
GAGTGGTTGCGTGGCATTGGCTGGATGCCCCAAGGGTCTCCTGAAGTGTTGAGAGTCAAAAACGCCCA
G
AATATCTTTTGTGACAGTGTCTATCGGACGCCTGTGGTGAACCTTAAGTACACAAGCATTGTTGACACA
CCT
GAAGTGGTCCTTGCTAAATCAAATGCTGAAAATATTAGTATTCCAAAGTACAGAGAGGTTTGGGACA
AG
GATAAAACTTCAATACACATAATGCCAGATACTCCAGAAATTAATCTCGCTAGAGCAAATGCTCTTAA
T
GTGAGCAATAAACTTTACCGTGAGGGCTGGGATGAAATGAAGGCGGGCTGTGATGTCCGGCTGGATGCC
ATC
CCCATCCAGGCTGCCAAGGCCTCCAGGGAGATTGCCAGTGACTATAAATATAAGCTTGACCATGAGA
AG
CAGAAGGGACACTACGTGGGCACCCTCACAGCCAGGGATGACAACAAGATCCGCTGGGCCCTCATAGC
T
GACAAGCTCCAGAATGAACGAGAGTACCGGCTGGACTGGGCCAAATGGAAGGCCAAGATCCAGAGCCCT
GTG
GACATGCTTTCCATCCTGCACTCTAAAAATTCCCAGGCTCTGGTCAGTGACATGGATTACCGCAATT
AC
CTGCACCAGTGGACCTGCATGCCCGACCAGAACGATGTGATTCAGGCCAAGAAGGCCTACGAACTGCA
G
AGCGATAATGTTTACAAGGCTGACTTGGAATGGTTGCGTGGAATTGGGTGGATGCCAAATGACTCCGTG
TCC
GTCAATCATGCCAAACATGCCGCGGACATCTTCAGTGAGAAAAAATATCGCACAAAAATAGAAACTC
TC
AACTTTACGCCTGTGGATGACAGAGTTGATTATGTGACAGCGAAACAAAGTGGCGAGATCCTCGATGA
T
ATTAAATACCGGAAAGACTGGAATGCCACCAAATCAAAGTACACCCTCACAGAAACCCCCCTGCTGCAC
ACT
GCCCAGGAGGCTGCTAGGATACTGGACCAGTATCTCTACAAGGAAGGCTGGGAGAGACAAAAAGCCA
CA
GGTTACATTTTGCCTCCAGATGCTGTGCCATTTGTTCATGCCCATCACTGCAATGACGTTCAGAGTGA
G
CTGAAATACAAAGCTGAACATGTGAAGCAAAAAGGTCATTATGTTGGTGTCCCGACGATGAGAGATGAT
CCT
AAGCTGGTTTGGTTTGAGCATGCAGGCCAGATTCAGAATGAGAGACTATACAAAGAGGACTATCACA
AA
ACAAAGGCCAAAATCAATATACCTGCTGATATGGTGTCAGTCTTGGCCGCCAAGCAGGGGCAGACCCT
T
GTCAGTGATATTGATTATCGTAATTACTTGCACCAATGGATGTGTCATCCTGACCAGAACGATGTTATT
CAG
GCAAGAAAGGCCTATGACCTACAGAGTGATAATGTCTACAGAGCTGACCTGGAGTGGCTCCGAGGCA
TT
GGCTGGATCCCACTGGATTCTGTGGACCATGTAAGGGTTACTAAGAACCAGGAAATGATGAGTCAGAT
C
AAATATAAGAAAAATGCCCTTGAAAACTATCCTAACTTTAGAAGTGTGGTGGATCCTCCAGAGATTGTT
TTA
GCCAAGATTAATTCTGTCAATCAAAGTGATGTAAAATATAAAGAAACATTTAATAAAGCAAAGGGCA
AA
TATACGTTTTCACCAGATACACCACATATCTCCCACTCCAAAGACATGGGAAAACTCTACAGTACTAT
A
CTGTATAAAGGGGCGTGGGAGGGCACCAAGGCCTATGGCTACACCCTGGATGAGCGCTACATTCCCATT
GTT
GGAGCCAAGCATGCTGATCTGGTGAACAGTGAGCTTAAATACAAAGAGACATATGAGAAGCAGAAAG
GT
CACTACCTGGCTGGAAAAGTGATCGGTGAATTCCCTGGTGTGGTTCACTGTCTGGATTTCCAAAAGAT
G
AGGAGTGCGTTGAACTACAGAAAACATTATGAGGATACCAAAGCAAATGTTCATATCCCCAATGACATG
ATG
AATCACGTGCTGGCTAAAAGGTGCCAGTACATCCTCAGTGACCTGGAGTATCGACACTATTTCCACC
AG
TGGACGTCTCTTCTGGAAGAACCCAATGTTATACGCGTCCGAAACGCCCAGGAGATCTTGAGTGATAA
T
GTGTATAAAGATGACCTGAATTGGTTGAAAGGCATTGGTTGCTACGTTTGGGATACACCCCAAATCCTC
CAT
GCCAAGAAATCATACGACCTTCAGAGTCAGCTACAATATACAGCAGCAGGTAAAGAAAATCTACAAA
AC
TATAATCTGGTCACAGACACGCCCCTCTATGTGACTGCTGTTCAGAGTGGCATTAATGCCAGTGAGGT
A
AAATATAAAGAAAATTATCATCAGATTAAGGACAAATACACAACAGTTCTAGAAACAGTGGATTATGAC
AGA
ACCAGAAACCTGAAGAATCTTTACAGCAGTAACCTGTACAAGGAGGCCTGGGATAGAGTGAAAGCCA
CC
AGCTACATCCTGCCTTCCAGCACCTTGTCCCTGACACACGCCAAGAACCAGAAGCATCTGGCCAGCCA
T
ATCAAATATCGGGAAGAATATGAAAAGTTCAAAGCTCTTTATACGTTACCAAGAAGTGTTGACGATGAT
CCG
AACACAGCACGGTGCCTCCGAGTTGGCAAGCTTAACATCGATCGCCTGTACAGATCAGTTTATGAAA
AG
AACAAGATGAAAATCCACATCGTGCCCGACATGGTAGAGATGGTTACTGCCAAGGATTCCCAGAAGAA
A
GTCAGTGAGATTGATTACCGCCTGCGCCTCCACGAATGGATTTGCCACCCCGACTTGCAAGTCAATGAT
CAC
GTCAGGAAAGTCACAGATCAGATCAGCGATATTGTATACAAGGATGACCTCAACTGGCTGAAAGGCA
TT
GGTTGCTACGTCTGGGACACTCCTGAAATCCTCCATGCCAAGCATGCTTATGATCTACGTGATGATAT
C
AAGTATAAAGCTCACATGTTGAAAACAAGGAATGACTACAAGCTTGTCACAGATACACCAGTCTACGTG
CAG
GCTGTCAAAAGTGGGAAACAGCTAAGTGACGCTGTCTACCACTATGACTATGTGCACAGTGTCAGAG
GC
AAAGTGGCTCCAACTACCAAAACCGTGGATCTGGACCGGGCCCTTCATGCATACAAGCTCCAGAGTTC
G
AATCTATACAAAACCAGCCTGCGCACCCTGCCCACTGGATATAGACTTCCAGGTGACACTCCTCACTTC
AAA
CACATCAAGGACACCCGTTACATGAGCAGTTATTTCAAGTACAAAGAAGCCTATGAACACACCAAGG
CA
TATGGGTATACACTTGGCCCCAAAGATGTTCCATTTGTCCACGTCCGGAGAGTCAACAATGTTACCAG
C
GAGAGACTGTATCGGGAATTGTACCACAAACTGAAAGACAAGATCCATACAACTCCCGATACCCCTGAG
ATC
CGCCAAGTCAAGAAGACACAAGAGGCTGTCAGTGAGTTGATCTACAAATCAGACTTCTTCAAGATGC
AG
GGCCACATGATCTCTCTGCCATACACACCCCAAGTGATCCATTGCCGCTATGTGGGAGACATCACCAG
T
GATATTAAATACAAAGAGGACTTGCAGGTCCTGAAGGGATTTGGCTGCTTCCTGTATGACACTCCTGAC
ATG
GTCCGCTCCCGGCACCTGCGGAAGCTCTGGTCTAATTACCTATACACTGATAAGGCAAGGAAGATGC
GA
GACAAATACAAAGTGGTGCTTGACACTCCAGAATACAGAAAAGTGCAAGAACTGAAGACACATCTGAG
T
GAGCTGGTCTACAGAGCTGCAGGCAAGAAGCAGAAGTCAATCTTTACTTCAGTTCCTGATACTCCTGAT
CTT
TTAAGAGCCAAGCGAGGGCAGAAGCTTCAGAGTCAGTATCTGTATGTTGAACTTGCCACCAAAGAGA
GA
CCCCATCATCACGCTGGAAACCAGACCACAGCCTTGAAGCATGCTAAAGACGTGAAGGACATGGTCAG
T
GAGAAAAAGTACAAGATTCAATATGAAAAGATGAAAGACAAGTACACTCCGGTTCCAGATACGCCAATC
CTC
ATCAGAGCCAAGAGGGCTTACTGGAATGCCAGTGATCTACGCTACAAAGAAACATTTCAAAAGACCA
AA
GGGAAATACCACACGGTGAAAGATGCCCTAGACATTGTCTATCATCGCAAAGTCACAGATGACATCAG
T
AAAATAAAATACAAGGAGAACTACATGAGCCAGTTGGGTATCTGGAGGTCCATTCCTGATCGTCCAGAG
CAT
TTCCACCACCGAGCAGTCACTGACACAGTCAGTGATGTAAAATATAAAGAAGACTTGACTTGGCTTA
AA
GGCATTGGTTGCTATGCCTATGATACCCCTGATTTCACTCTGGCTGAAAAGAACAAGACTCTCTACAG
C
AAGTATAAGTATAAAGAAGTATTTGAAAGGACAAAGTCAGATTTCAAGTATGTTGCCGACTCTCCGATC
AAT
AGGCATTTCAAGTATGCAACTCAATTGATGAATGAGAAAAAATACAGAGCTGATTATGAGCAGCGGA
AA
GATAAATACCACCTGGTAGTCGATGAGCCTAGACATCTGCTGGCTAAGACCGCAGGCGACCAGATCAG
T
CAGATCAAATACAGGAAAAACTATGAAAAATCAAAGGACAAATTTACCTCAATTGTGGATACTCCAGAA
CAC
CTGCGTACTACAAAAGTCAACAAACAAATCAGCGATATCCTTTATAAATTGGAATACAACAAGGCCA
AA
CCCAGAGGCTACACCACAATCCACGACACACCCATGTTGCTGCATGTCCGCAAGGTTAAAGATGAAGT
C
AGTGATCTGAAATACAAAGAAGTATACCAAAGAAATAAATCCAACTGCACCATTGAGCCAGATGCTGTT
CAT
ATCAAAGCAGCCAAGGACGCCTACAAAGTCAACACCAATCTGGACTATAAGAAACAGTACGAAGCCA
AC
AAAGCCCACTGGAAGTGGACTCCTGACCGACCGGACTTCCTCCAGGCTGCCAAGTCATCCCTGCAGCA
A
AGCGATTTTGAATATAAGCTGGACCGGGAGTTCCTCAAGGGTTGCAAGCTTTCTGTCACTGATGACAAA
AAC
ACGGTGCTCGCCCTCAGGAATACTTTAATAGAAAGTGATCTGAAATACAAAGAGAAACATGTCAAGG
AA
AGAGGAACCTGCCATGCCGTACCTGACACGCCTCAGATCCTGCTGGCGAAGACTGTCAGCAACCTGGT
G
TCTGAGAACAAGTACAAGGACCATGTCAAGAAGCACTTGGCACAGGGCTCATACACAACACTACCAGAG
ACC
CGGGACACTGTTCACGTCAAGGAAGTGACCAAGCATGTCAGTGATACAAATTACAAAAAGAAGTTTG
TC
AAGGAGAAAGGAAAATCCAACTACTCCATCATGCTGGAGCCACCAGAGGTGAAACATGCTATGGAAGT
G
GCCAAGAAGCAAAGTGATGTCGCTTACAGAAAAGATGCCAAAGAGAACCTGCATTACACCACAGTGGCT
GAT
CGACCAGACATCAAGAAGGCCACACAGGCAGCCAAACAGGCCAGTGAGGTGGAGTACAGAGCCAAGC
AC
CGCAAGGAAGGCAGCCATGGCTTAAGCATGCTCGGTCGCCCAGACATAGAAATGGCCAAGAAGGCAGC
C
AAGCTGAGCAGCCAGGTTAAATACCGAGAAAATTTCGATAAAGAAAAGGGCAAGACACCAAAATACAAT
CCA
AAAGACAGCCAGCTCTACAAAGTCATGAAAGATGCTAATAATCTTGCAAGTGAGGTTAAATACAAGG
CT
GACCTGAAGAAACTTCACAAACCCGTGACTGACATGAAGGAGTCTCTGATCATGAATCATGTCCTGAA
T
ACAAGCCAACTTGCCAGTTCTTACCAGTACAAGAAGAAGTATGAGAAGAGTAAAGGCCACTACCACACC
ATA
CCCGATAATCTGGAGCAGCTTCACCTAAAAGAGGCCACAGAATTACAGAGTATAGTGAAATACAAAG
AA
AAGTATGAAAAGGAACGAGGAAAACCCATGCTGGACTTTGAAACACCAACGTACATCACTGCCAAAGA
G
TCTCAGCAGATGCAGAGTGGGAAAGAATATAGGAAAGATTATGAAGAGTCCATTAAAGGCAGAAACCTG
ACT
GGCCTGGAGGTCACGCCAGCTTTGTTACATGTCAAATATGCAACTAAAATAGCAAGCGAGAAAGAGT
AC
AGGAAAGATCTAGAGGAAAGCATCCGTGGGAAGGGCCTCACTGAAATGGAAGATACACCTGACATGCT
A
AGAGCAAAGAATGCCACTCAAATCCTCAATGAGAAAGAATATAAGCGAGACCTGGAACTGGAAGTCAAA
GGA
AGAGGCCTGAATGCCATGGCCAATGAAACTCCGGATTTTATGAGGGCCAGGAATGCTACTGATATTG
CC
AGTCAGATTAAGTATAAGCAATCAGCAGAAATGGAGAAAGCCAATTTCACTTCTGTGGTTGATACTCC
A
GAGATCATTCATGCCCAACAAGTCAAGAATCTTTCAAGCCAGAAAAAGTACAAGGAAGATGCTGAGAAG
TCC
ATGTCGTATTATGAGACTGTTTTGGACACCCCAGAGATACAGAGAGTCCGGGAGAACCAAAAGAACT
TC
AGCCTTCTCCAATACCAGTGTGACCTTAAAAACAGTAAAGGAAAAATTACAGTTGTTCAAGACACGCC
A
GAAATACTGCGTGTAAAAGAAAATCAGAAGAATTTCAGCTCGGTTTTATATAAAGAGGATGTCTCACCA
GGA
ACGGCTATCGGAAAGACACCTGAGATGATGAGAGTGAAACAAACACAGGACCACATTAGCTCGGTGA
AG
TATAAGGAAGCAATAGGACAAGGAACTCCAATCCCTGACCTGCCTGAAGTGAAACGTGTGAAGGAGAC
G
CAGAAGCACATTAGCTCGGTTATGTACAAAGAAAACTTGGGAACAGGCATTCCAACCACTGTGACTCCA
GAG
ATTGAGAGAGTCAAACGCAATCAAGAGAACTTTAGCTCGGTTTTGTACAAAGAAAATTTGGGGAAAG
GA
ATCCCAACACCTATCACTCCAGAGATGGAGAGAGTCAAACGCAATCAAGAGAACTTTAGCTCGGTGTT
A
TACAAAGAAAACATGGGCAAGGGAACTCCTTTAGCTGTCACTCCCGAGATGGAGCGAGTCAAACACAAT
CAA
GAAAATATT