NCBI CCDS banner
PubMed Entrez Gene BLAST OMIM
  

CCDS
Home
FTP
Process
Releases & Statistics

Collaborators
EBI
HGNC
MGI
NCBI
WTSI

Contact Us
email CCDS

Genome Displays

Ensembl
NCBI
UCSC
VEGA

Related Resources
Gene
HomoloGene
RefSeq

Report for CCDS38154.1 (current version)

CCDS Status Species Chrom. Gene CCDS Release NCBI Annotation Release Ensembl Annotation Release Links
38154.1 Public Mus musculus 2 Ttn 21 106 86 CCDS HistoryNCBI Gene:22138Re-query CCDS DB by CCDS ID:38154.1Re-query CCDS DB by GeneID:22138See the combined annotation on chromosome 2 in Sequence Viewer

Public since: CCDS release 4, NCBI annotation release 37.1, Ensembl annotation release 47

Review status: Provisional (this record has not been manually reviewed by the collaboration)

Sequence IDs included in CCDS 38154.1

Original Current Source Nucleotide ID Protein ID Status in CCDS Seq. Status Links
Original member Current member EBI,WTSI ENSMUST00000111846 ENSMUSP00000107477 Accepted alive Link to Ensembl Transcript Viewer:ENSMUST00000111846Link to Ensembl Protein Viewer:ENSMUSP00000107477Re-query CCDS DB by Nucleotide ID:ENSMUST00000111846Re-query CCDS DB by Protein ID:ENSMUSP00000107477
Original member Current member NCBI NM_011652.3 NP_035782.3 Accepted alive Link to Nucleotide Sequence:NM_011652.3Link to Protein Sequence:NP_035782.3Re-query CCDS DB by Nucleotide ID:NM_011652Re-query CCDS DB by Protein ID:NP_035782Link to BLAST:NP_035782.3

Chromosomal Locations for CCDS 38154.1

Assembly GRCm38.p4 (GCF_000001635.24)

On '-' strand of Chromosome 2 (NC_000068.7)
Genome Browser links: Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2See the combined annotation on chromosome 2 in Sequence Viewer

Chromosome Start Stop Links
2 76705031 76705329 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76705670 76705972 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76706440 76706593 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76706697 76707388 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76708159 76708315 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76708448 76708597 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76708754 76714212 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76714329 76714922 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76715144 76715449 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76715540 76716115 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76716749 76717048 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76717173 76717478 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76717611 76718195 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76718295 76718597 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76718874 76719176 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76719681 76719980 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76720082 76720369 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76720480 76721073 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76721234 76721515 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76721601 76721906 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76722759 76723064 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76723193 76723489 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76723576 76723866 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76723979 76724284 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76724374 76724676 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76724778 76726844 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76726934 76727233 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76727346 76727633 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76728309 76728602 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76729123 76730889 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76730995 76731300 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76731395 76731697 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76731943 76732242 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76732352 76732639 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76733718 76734014 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76734120 76734422 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76734513 76735100 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76735226 76735522 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76736064 76753169 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76753284 76753586 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76753688 76754275 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76754366 76754662 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76754758 76754955 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76755299 76755403 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76755499 76756086 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76756267 76756554 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76756641 76756931 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76757028 76757315 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76758292 76758597 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76758692 76758994 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76759086 76759382 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76759838 76760125 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76761086 76761385 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76761654 76761956 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76762152 76762451 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76762570 76762845 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76763236 76763538 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76763847 76764146 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76764245 76764529 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76764634 76764954 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76765718 76768684 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76768781 76769074 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76769157 76769456 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76769540 76769821 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76769938 76770246 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76770339 76770641 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76770733 76771032 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76771124 76771405 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76771504 76771806 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76772367 76772669 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76774382 76774663 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76774754 76774904 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76775591 76775739 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76775839 76776153 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76776255 76776554 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76776668 76776964 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76777865 76778182 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76778276 76778575 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76778665 76778794 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76778889 76778921 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76779006 76779154 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76779278 76779586 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76780713 76781142 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76781513 76781703 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76781789 76782097 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76782190 76782489 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76783924 76784217 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76784321 76784605 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76784708 76785004 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76785102 76785401 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76785530 76785832 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76786143 76786505 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76786617 76786919 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76787027 76787326 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76788140 76788418 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76788514 76788819 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76788903 76789099 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76789214 76789319 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76789412 76789711 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76789879 76790178 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76790269 76790384 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76790796 76790982 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76791087 76791383 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76791486 76791773 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76791864 76791985 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76792791 76792968 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76793109 76793256 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76794152 76794303 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76794410 76794694 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76794799 76794913 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76795055 76795242 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76795479 76795781 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76795878 76796180 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76796270 76796539 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76797239 76797505 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76797613 76797737 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76797848 76798256 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76798351 76798629 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76798714 76798980 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76799084 76799350 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76799440 76799608 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76800483 76800580 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76802231 76802497 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76803293 76803416 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76807061 76807203 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76807991 76808117 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76808520 76808659 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76808751 76809017 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76809853 76810119 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76810260 76810526 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76810648 76810774 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76810912 76811051 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76811142 76811405 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76811523 76811789 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76812112 76812375 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76812477 76812603 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76812887 76813026 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76813336 76813611 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76814138 76814416 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76814518 76814919 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76815528 76815575 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76816159 76816248 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76816543 76816605 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76816989 76817075 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76817789 76817863 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76818736 76818816 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76821116 76821184 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76822451 76822564 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76826075 76826152 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76826447 76826542 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76826995 76827078 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76827483 76827560 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76827692 76827766 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76827885 76827968 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76828101 76828187 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76828319 76828402 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76828680 76828763 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76828873 76828956 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76832101 76832184 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76832463 76832546 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76832656 76832721 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76839405 76839482 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76840233 76840313 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76841090 76841389 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76841534 76841626 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76841768 76841836 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76842771 76842848 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76843376 76843492 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76844205 76844279 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76845022 76845096 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76846626 76846916 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76847113 76847196 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76847388 76847471 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76847725 76847808 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76848279 76848356 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76848559 76848642 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76848817 76849170 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76849257 76849334 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76849995 76850087 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76850306 76850380 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76850570 76850644 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76851555 76851764 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76852057 76852137 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76852834 76852917 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76853155 76853238 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76853605 76853688 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76853851 76853928 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76854150 76854218 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76854387 76854467 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76856265 76856366 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76856803 76856904 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76857155 76857229 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76857397 76857474 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76857610 76857690 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76857904 76857987 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76859460 76859546 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76859914 76859997 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76861097 76861177 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76861423 76861509 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76862112 76862189 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76862350 76862427 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76862800 76862859 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76863274 76863675 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76864272 76864325 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76865223 76865297 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76867158 76867241 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76867422 76867481 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76867883 76867909 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76868008 76868085 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76868287 76868496 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76870351 76870611 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76870710 76870977 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76871076 76871165 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76871705 76871888 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76872681 76872966 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76873067 76873159 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76873711 76873998 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76875691 76875981 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76876452 76876739 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76876882 76877169 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76877903 76878181 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76878268 76878546 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76878674 76878952 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76879058 76879345 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76879983 76880261 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76880375 76880656 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76881064 76881342 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76881558 76881839 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76883910 76884197 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76884346 76884633 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76884752 76885030 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76885125 76885403 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76885497 76885775 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76885928 76886215 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76886308 76886586 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76886725 76887006 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76887107 76887385 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76887806 76888087 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76888886 76889173 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76889304 76889591 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76889709 76889987 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76890094 76890372 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76890465 76890743 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76890907 76891194 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76891312 76891590 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76892504 76892785 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76892899 76893177 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76894142 76894423 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76894660 76894902 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76895142 76895429 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76895533 76895811 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76895924 76896202 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76896320 76896598 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76896699 76896980 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76897122 76897400 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76897515 76897802 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76898063 76898341 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76898445 76898723 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76898838 76899116 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76899208 76899489 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76899591 76899869 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76899980 76900267 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76900382 76900660 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76900757 76901035 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76901464 76901742 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76901841 76902122 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76903063 76903626 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76906254 76906532 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76921551 76921607 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76927087 76927275 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76932132 76932257 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76932446 76932730 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76934139 76934370 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76936382 76936547 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76936635 76936776 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76937573 76937833 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76938307 76938567 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76938694 76938954 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76939044 76939307 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76939850 76940110 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76941822 76942082 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76942176 76942439 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76942847 76943119 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76943201 76943467 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76943891 76944172 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76944309 76946002 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76946117 76946285 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76946392 76946556 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76946697 76946980 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76947828 76948072 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76948187 76948420 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76948938 76949143 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76950015 76950157 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76951315 76951530 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76951647 76951707 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76951920 76952178 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76952770 76952835 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76953001 76953288 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76954586 76954708 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76954795 76955088 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76964475 76964612 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76965091 76965228 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76965777 76965914 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76967054 76967185 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76968396 76968533 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76969140 76969292 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76969621 76969951 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76974016 76974257 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76974351 76974436 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76974911 76975198 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76977093 76977296 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2
2 76980092 76980182 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 2Link to Ensembl Genome Browser on chromosome 2

CCDS Sequence Data
Blue highlighting indicates alternating exons.
Red highlighting indicates amino acids encoded across a splice junction.
 
Mouse over the nucleotide or protein sequence below and click on the highlighted codon or residue to select the pair.

Nucleotide Sequence (100404 nt):
ATGACTACTCAAGCACCGATGTTTACGCAGCCGTTACAAAGCGTTGTGGTACTGGAGGGTAGTACCGCAA
CC
TTTGAGGCTCACGTTAGTGGTTCCCCAGTTCCTGAGGTGAGCTGGTTTCGGGATGGCCAGGTGATTTC
A
ACTTCCACTCTGCCCGGCGTGCAGATCTCCTTTAGCGATGGCCGCGCTAGATTGATGATCCCCGCCGTG
ACT
AAAGCCAACAGTGGACGATACTCCCTGAGAGCCACCAATGGATCTGGACAAGCGACTAGTACTGCTG
AG
CTTCTTGTGACAGCCGAGACAGCACCACCCAACTTCAGTCAGCGGCTGCAGAGCATGACTGTGAGACA
A
GGAAGCCAAGTGAGACTCCAAGTGAGAGTGACTGGAATCCCTACACCTGTGGTGAAGTTCTACCGGGAT
GGA
GCCGAAATCCAGAGCTCCCTTGATTTCCAAATTTCTCAAGAAGGAGACCTCTACAGCTTACTGATTG
CC
GAAGCATACCCTGAAGACTCCGGGACCTATTCTGTAAATGCCACCAACAGCGTTGGAAGAGCTACTTC
C
ACTGCAGAATTGGTGGTTCAAGGTGAAGAAGTAGTACCTGCTAAAAAGACAAAGACGATCGTGTCGACT
GCT
CAGATTTCAGAAACAAGACAAACCCGGATTGAAAAAAAGATTGAAGCCCACTTTGATGCCAGATCAA
TC
GCAACAGTTGAGATGGTCATAGATGGTGCCACTGGACAGCTGCCACATAAAACACCTCCCAGGATACC
T
CCTAAGCCCAAGTCCAGGTCTCCGACACCACCTTCCATTGCTGCCAAAGCACAGCTGGCCAGACAACAG
TCC
CCATCACCAATAAGACACTCTCCCTCCCCAGTCAGACACGTGCGGGCACCAACCCCATCTCCAGTCA
G
G
TCCGTGTCTCCAGCGGGGAGGATCTCCACTTCCCCGATCAGATCCGTGAAGTCGCCACTGCTCATTCG
C
AAGACTCAGACCACCACCATGGCCACAGGCCCCGAGGTGCCTCCCCCTTGGAAGCAAGAGGGCTACGTG
GCC
TCCTCGACTGAGGCTGAGATGAGAGAGACGACAATGACAAGCTCTACCCAGATCAGAAGAGAAGAGA
GG
TGGGAAGGGAGATACGGGGTCCAGGAGCAAGTGACCATCAGTGGAGCCGCGGCTGCTGCGGCCAGTGC
G
TCGGTCAGCTCGTCATTCACGGCAGGAGCCATCACCACTGGGACTAAGGAGGTGAAACAAGAGACAGAC
AAG
AGTGCAGCTGTTGCGACTGTCGTTGCTGCTGTTGATATGGCCAGAGTGAGAGAACCAGCCATCAGTG
CT
GTAGAGCAAACTGCTCAGAGGACAACCACGACTGCTGTGCATATACAACCTGCTCAAGAACAGGCGAG
A
AAAGAGGCGGAGAAGACCGCAGTAACCAAGGTTGTAGTTGCTGCCGATAAAGCCAAGGAACAGGAACTA
AAA
TCACGAACCAGAGAAGTGATGGTGACAACGCAAGAGCAGACTCACATATCTCATGAGCAGATAAGAA
AA
GAAACTGAAAAAGCATTTGTACCAAAGGTAGTGATCTCCGCAACCAAAGCCAAAGAGCAAGAAACTAG
A
ATCACGGGAGAAATTACTACAAAACAAGAGCAAAAGCGAATAACTCAAGAAACAATAAGACAGGAAACT
GAG
GAAATTGCTGCATCCATGGTAGTGGTTGCCACCGCCAAGTCCACAAAACTAGAGGCAGCTGTGGGAG
TT
CAAGAAGAGACTGCCATACAACAGGATCAAATGCACCTCACTCATGAACAGATGATGAAGGAAACTAG
G
AAAACAGTGGTACCCAAAGTCATAGTTGCCACGCCCAAGATTAAAGAGCAAGATTTAGTATCAAGAAGT
AGA
GAAGCCATCACTACCAAAAGAGATCAAGTTCAAATAACTCAGGAAAAGAAGAGAAAGGAAGTGGAAA
CA
ACTGCCTTGTCTACAATAGCAGTTGCTACTGCTAAAGCCAAAGAGCAAGAAACAGTTCTGAGGTCTAG
A
GAAGCCATGGCCACTAGACAAGAACACATCCAAGTTACCCATGGACAGGTGGGCGTTGGGAAGAAGGCA
GAA
GCCGTGGCAACAGTTGTAGCTGCTGTGGACCAGGCCCGAGTGAGGGAACCCAGAGAGCCTACGCATG
TG
GAGGAATCGCATTCTCAGCAGACTACGTTAGAGTATGGCTACAAAGAACACATTTCCACCACAAAGGT
C
CCAGAGCAGCCCCGGCGCCCAGCCTCAGAGCCCCACGTTGTCCCTCAAGCAGTCAAGCCTGCTGTGATT
CAG
GCTCCTTCTGAGACTCATATCAAAACTACTGACCAAATGGGAATGCATATATCGTCACAGGTCAAGA
AA
ACTACAGATATCTCAACAGAAAGATTAGTTCATGTGGATAAACGCCCCCGCACAGCGAGCCCTCACTT
T
ACTGTTTCAAAAATTTCTGTACCTAAGACAGAACATGGATATGAGGCATCGATAGCTGGTAGCGCTATC
GCC
ACACTACAAAAAGAATTGTCAGCCACATCTTCAACTCAGAAGATCACCAAATCCGTGAAGGCACCCA
CC
GTGAAGCCTGGGGAGACGAGAGTAAGGGCGGAGCCCACCCCTTCCCCACAGTTCCCCTTTGCTGACAT
G
CCGCCGCCAGACACTTACAAGAGTCAGGCTGGCATTGAGGTGAAGAAGGAAGTCGGGGTGAGCATCAGT
GGC
AGCACCGTTCGTGAGGAGCACTTCGAAGTACTGCGCGGACGTGAAGCCAAGGTAACAGAGACAGCAC
GA
GTGCCTGCTCCTGCTGAAGTGCCTGTTACTCCGCCTACCTTGGTCTCGGGCTTAAAAAACGTGACTGT
C
ATAGAAGGCGAATCTGTCACCTTGGAGTGCCACATCTCTGGATACCCATCCCCCAAGGTGACATGGTAC
AGA
GAAGACTACCAAATCGAAAGTTCCATTGATTTCCAGATAACCTTCCAGGGTGGAATTGCTCGTCTCA
TG
ATCCGCGAAGCCTTTGCGGAAGACAGCGGACGGTTTACCTGCAGCGCCGTGAATGAGGCCGGGACCGT
C
AGCACTTCCTGCTATCTTGCTGTGCAAGTGTCAGAAGAGTTTGACAAGGAAACAACTCTGACTGAGAAA
TTT
GCCACCGAAGAGAAACGCTTCGTGGAGTCAAGAGATGTAGTCATGACCGACACCAGCATCACAGAGG
AG
CAGGCAGGGCCTGGAGAGCCTGCTGCGCCTTTCTTCATTTCAAAGCCGGTGGTCCAGAAACTGGTGGA
G
GGTGGGAGTGTTGTGTTTGAATGCCAGATCGGCGGCAACCCAAAGCCCCACGTCTACTGGAAAAAATCT
GGC
GTTCCTCTCACCACTGGATACAGATACAAAGTGAGTTATAACAAGCAGACTGGGGAATGCAGACTGG
TG
ATTTCTATGACGTTCGCTGATGATGCTGGAGAATACACTATTGTCATCCGAAACAAGCACGGGGAGAC
G
TCTGCATCTGCCTCCTTGCTGGAGGAAGCTGATTACGAGGCATTGGTGAAGACTCAGCAAGAAATGCTT
TAC
CAGACACAAATGAGCACATTTATTCAAGAACCCAAAGTGGGGGAAATAGCACCTGGATTTGCATATT
CT
GAATATGAGAAGGAATATGAAAAGGAACAGGCCTTAATTAGGAAGAAAATGGCCAAAGATACTGTGAT
G
GTCAGGACTTTTGTAGAAGACCAAGAATTCCACATCTCTTCTTTTGAAGAGAGGCTCATTAAAGAGATT
GAA
TACAGAATAATAAAGACTACGCTGGAAGAACTTCTTGAGGAGGATGGAGAAGAGAAGATGGCAGTCG
AC
ATTTCTGAATCTGAAGCTATCGAGTCAGGATTTGATATAAGGATAAAAAATTATAGAATTCTTGAGGG
G
ATGGGTGTCACTTTTCATTGCAAGATGTCTGGATATCCGTTACCCAAGATTGCGTGGTATAAGGATGGC
AAG
CGCATCAGACATGGGGAAAGATATCAAATGGACTTTCTACAAGATGGCAGAGCCAGCCTGCGTATAC
CT
GTTGTCCTTCCAGAGGACGAGGGCATCTATACTGCATTTGCCAGCAATATCAAAGGAAATGCGATTTG
C
TCTGGGAAGCTGTACGTGGAGCCTGCTGCACCATTTAGCGCTCCAACTTACATGCCCACACCAGAAGCA
GTG
AGCAGAATCAGGTCTGTCTCTCCACGTTCACTGAGCAGGTCACCTATACGTATGTCTCCTGCGATGT
CC
CCTGCACGAATGTCCCCCGCACGGATGTCCCCTGCACGGATGTCCCCCGCACGGATGTCTCCTGGACG
C
AGGCTGGAGGAGACAGATGAATCACAGCTGGAGAGACTGTATAAGCCAGTCTTTGTATTAAAACCTGCT
TCT
TTCAAATGTTTAGAAGGACAGACTGCCAGATTTGACTTGAAGGTTGTGGGCAGACCCATGCCAGAGA
CA
TTCTGGTTTCACAATGGACAGCAAATTGTCAATGATTATACGCACAAAGTCGTCATTAAAGAAGATGG
A
ACTCAGTCACTGATCATTGTCCCTGCGTCACCCAGCGATTCAGGAGAATGGACAGTGGTGGCCCAAAAC
AGA
GCAGGAAAATCCACAATATCTGTGACTTTAACTGTAGAAGCTGTGGAACACCAGATCAAGCCAGCAT
TT
GTGGAAAAACTGAAAAATGTCAACATAAAGGAAGGTTCCAGGCTCGAAATGAAAGTCAGAGCTACAGG
C
AACCCCAACCCTGACATTGTGTGGCTGAAAAACAGTGACATCATTGTTCCTCATAAATACCCAAGGATC
AG
G
ATTGAAGGAACCAGAGGAGAAGCCGCCCTTAAGATTGATTCCATTATCAGCCAAGATTCAGCCTGGT
AT
ACAGCCACGGCTATTAACAAGGCAGGCCGAGACACCACAAGGTGCAAAGTCAATGTTGAGGTTGAGTT
T
GCAGAACCTGAACCGGAAAGAAAGCTGATTATTCCACGAGGAACGTACAGAGCAAAGGAGATTGCTGCC
CCA
GAACTGGAGCCTCTCCATTTGAGATACGGTCAAGAACAGTGGGAGGAGGGTGACCTCTATGACAAGG
AG
AAACAACAGAAACCGTTTTTCAAGAAAAAACTCACTTCCCTCAGACTGAAGCGCTTTGGACCTGCCCA
C
TTTGAGTGCAGACTCACACCAATTGGTGACCCAACCATGGTGGTGGAGTGGCTTCACGATGGGAAGCCC
CTG
GAGGCGGCCAACAGGCTTCGGATGATTAATGAATTCGGCTACTGCAGCCTTGATTATGGAGCAGCGT
AT
TCCAGAGACAGTGGTGTCATCACCTGCAGAGCTACTAACAAATATGGGACAGATCACACCTCTGCTAC
T
CTTATTGTCAAAGATGAGAAAAGCCTAGTGGAAGAATCTCAACTGCCTGATGGGAAAAAAGGCTTACAG
AGG
ATAGAAGAACTAGAGAGAATGGCTCACGAAGGTGCGCTGACAGGTGTGACAACAGATCAAAAAGAAA
AA
CAAAAGCCAGACATTGTCTTGTTCCCAGAGCCAGTGAGAGTGCTGGAAGGGGAGACAGCCAGATTCCG
C
TGCCGAGTGACAGGCTACCCTCAGCCCAAGGTCAACTGGTACCTCAATGGACAGCTCATCCGGAAAAGC
AAA
AGGTTCAGAGTTCGCTATGATGGCATTCACTATCTGGATATTGTGGACTGCAAATCCTATGACACAG
GT
GAAGTCAAGGTCACTGCGGAAAATCCTGAAGGTGTGACGGAACACAAAGTAAAACTTGAAATCCAACA
G
AGGGAGGATTTCAGATCTGTCCTTAGGCGTGCTCCCGAGCCAAAGCCCGAGTTTCATGTACACGAACCG
GGG
AAACTTCAGTTCGAAGTGCAGAAGGTAGACAGACCCGTGGACACCAGCGAAACCAAAGAAGTGGTGA
AG
CTGAAAAGGGCTGAAAGGATTACCCATGAGAAGGTGTCCGAGGAGTCTGAAGAACTGCGCAGTAAATT
T
AAGCGCCGGACGGAAGAGGGATACTATGAAGCCATCACAGCCGTGGAGCTGAAGTCTCGCAAGAAGGAT
GAG
TCTTACGAAGAGCTCCTCAAGAAAACTAAAGATGAGCTTCTGCACTGGACCAAAGAGTTAACTGAAG
AG
GAGAAGAAAGCCTTGGCTGAAGAAGGCAAAATCACGATTCCAACCTTTAAACCTGAGCGAATCGAACT
T
AGCCCTAGTATGGAGGCACCCAAAATCTTTGAACGAATCCAGAGCCAGACCGTTGGCCAAGGATCTGAT
GCT
CACTTTAGAGTCAGGGTTGTGGGAAAACCAGACCCTGAGTGTGAATGGTATAAAAATGGTGTAAAAA
TT
GAGCGATCTGACCGAATCTACTGGTACTGGCCAGAAGACAATGTTTGTGAACTGGTCATAAGAGATGT
A
ACTGCAGAGGACTCTGCCAGCATCATGGTAAAGGCCATCAACATAGCTGGGGAAACCTCAAGCCACGCA
TTC
CTGCTCGTCCAAGCCAAGCAACTGATCACTTTTACACAAGAATTGCAAGATGTTGTTGCTAAGGAAA
AG
GACACCATGGCAACATTTGAATGTGAAACTTCAGAACCATTTATCAAAGTAAAATGGTATAAAGATGG
T
ATCGAAGTTCATGCAGGGGATAAGTATAGGATGCACTCTGACCGAAAAGTTCACTTCCTGTCTGTGCTG
ACC
ATCGACACATCTGATGCTGAAGACTACAGCTGTGTACTTGTGGAAGATGAAAATATCAAGACGACAG
CG
AAACTTATTGTGGAAGGTGCAGTAGTTGAATTTGTGAAAGAACTTCAGGACATAGAAGTCCCAGAGTC
A
TACTCAGGAGAGTTAGAGTGCATCATATCTCCAGAAAACATAGAAGGCAAATGGTATCACAATGATGTG
GAG
TTGAAGTCCAATGGCAAATACTCAATTACATCCCGCCGTGGGCGCCAGAACCTCACAGTCAAGGATG
TA
ACCAAAGAGGACCAGGGAGAGTACAGCTTTGTTGTTGATGGGAAAAAGACAACCTGTAAACTGAAGAT
G
AAACCCCGACCTATTGCTATTCTCCAAGGACTTAGCGATCAAAAGGTCTGCGAGGGTGACATTGTTCAA
CTT
GAAGTCAAAGTCTCCTTAGAAAATGTAGAAGGTGTCTGGATGAAAGATGGTCAAGAAGTACAACACA
GT
GACAGAGTTCACATTGTAATAGACAAGCAGTCCCACATGCTACTTATTGAAGACATGACCAAAGAAGA
T
GCTGGGAATTACTCCTTCACTATTCCTGCCCTTGGACTCTCCACCAGTGGGAATGTCTCTGTCTATAGT
GTT
GATGTGATAACACCTCTCAAAGATGTCAATGTGATTGAAGGTACCAAGGCTGTACTTGAATGCAAGG
TC
TCAGTTCCCGATGTAACTTCTGTTAAATGGTACCTAAATGATGAACAAATCAAGCCTGATGATCGTGT
G
CAATCCATTGTCAAAGGCACCAAACAGCGACTTGTGATTAACCGAACCCATGCTTCTGATGAAGGACCT
TAC
AAGCTGATGGTTGGCAGGGTGGAAACCAGCTGTAACCTGTCTGTAGAGAAAATTAAAATTATCAGAG
GT
CTCCGTGACCTTACCTGCACAGAAACACAAAATGTGGTCTTTGAGGTTGAGCTATCCCACTCAGGAAT
T
GATGTTGTATGGAATTTTAAGGGCAAGGAAATTAAGCCCAGTTCTAAATATAAAATTGAAGCTCATGGG
AAA
ATATACAAACTGACAGTCCTCAATATGATGAAAGATGATGAAGGGGAGTATGCATTCTATGCAGGAG
AA
AATACAACATCTGGAAAGCTAACTGTGGCAGGAGGAGCCATCTCCACACCACTCACAGACCAGACTGT
G
GCTGAATCCCAGGAGGCTGTGTTTGAATGTGAAGTTGCCAACCCTGAGTCTGAGGGGGAATGGCTGAAG
GAT
GGAAAGCACTTGGCTCTGAGTAACAACTTCAGAGGTGAATCCGATGGCCACAAAAGGAGGCTTGTCA
TC
GCTGCCGCCAAGTTAGATGACGCTGGAGAATATACCTACAAGGTGGCTACCTCCAAAACATCTGCCAA
G
CTGAAAGTTGAAGCTGTCAAAATTAAGAAGACCCTGAGGAACCTCACTGTGACAGAGACACAGGATGCA
GTC
TTCTCTGTTGAACTCACACACCCAGATGTCAAAGGGGTCCAGTGGATCAAAAACGGAGTTGTCTTAG
AT
TCCAACGACAAGTATGAGATCTCAGTCAAAGGGACACTTTATTCACTGAAGATTAAAAACTGTGCCAT
G
GCAGATGAATCTGTCTACGGCTTCAAACTGGGGAGGCTAGGAGCTAGCGCCCGGCTGCACGTTGAGACT
GTC
AAGATTATTAAGAAACCAAAGGACGTGACCGCCTTGGAAAACGCCACTGTTACCTTCGAAGTCAGTG
TT
TCCCATGACACGGTGCCAGTAAAATGGTTCCATAAGAACGTGGAGATTAAGCCAAGTGACAAGCACAG
A
CTGGTCTCAGAGAGAAAAGTCCACAAACTCATGCTTCAGAGCATCTCCCCCTCGGATGCCGGCGAGTAC
ACA
GCCATGGTGGGCCAGCTGGAGTGCAAAGCCAAGCTGTTTGTGGAGACACTCCATATCACAAAGACTA
TG
AAAAGTATCGAGGTTCCTGAAACCAAAGCTGCCTCTTTCGAGTGTGAGGTGTCCCACTTCAATGTCCC
C
TCCATGTGGCTAAAGAACGGAGTGGAAATTGAGATGAGTGAAAAATTCAAGATCGTCGTGCAGGGGAAA
CTG
CACCAGCTGATCATCATGAACACGAGCACGGAGGACTCAGCGGAATACACATTTGTTTGTGGCAATG
AC
CAAGTCAGTGCTACCCTGACAGTGACCCCAATCATGATTACATCCATGCTGAAAGACATCAATGCTGA
A
GAAAAAGATACCATAACTTTTGAGGTGACAGTAAACTATGAAGGCATCTCTTACAAATGGTTAAAGAAC
GGT
GTGGAGATCAAGTCGACTGACAGGTGCCAGATGAGAACCAAGAAGCTCACGCACTCGCTGAACATCA
GG
AATGTTCACTTTGGAGATGCTGCTGATTATACTTTTGTGGCTGGAAAAGCCACATCGACGGCCACCCT
T
TATGTGGAAGCTCGTCATATAGAATTTAGGAAACACATTAAGGATATTAAGGTTCTGGAGAAGAAACGA
GCC
ATGTTTGAATGTGAAGTTTCTGAGCCCGACATAACTGTTCAGTGGATGAAAGATGGCCAAGAGCTTC
AG
ATAGCAGACAGGATAAAGATCCAGAAGGAGAAATATGTCCACCGCCTTCTGATCCCATCCACACGCAT
G
TCTGATGCCGGGAAATATACAGTGGTGGCAGGAGGCAACATGTCAACTGCTAACCTCTTTGTCGAAGGC
AGG
GATGTCCGCATCCGGAGCATTAAGAAGGAGGTCCAGGTCATTGAGAAGCAGCGTGCTGTCGTGGAGT
TC
GAAGTCAATGAGGATGACGTAGACGCCCACTGGTATAAAGATGGCATTGAAATCAACTTCCAAGTTCA
A
GAGCGACACCAGTATGTGGTGGAGAGAAGAATTCACCGGATGTTTATATCAGAAACAAGACACAGTGAC
GCA
GGCGAATACACCTTTGTGGCAGGCAGAAACAGGAGTTCTGTGACTCTTTATGTCAATGCTCCAGAAC
CA
CCCCAAGTCCTGCAGGAACTCCAGCCTGTCACTGTACAGTCCGGCAAGCCGGCTCGCTTCTGCGCCGT
G
ATATCAGGCAGACCGCAGCCCAAAATTTCCTGGTACAAGGAGGAGCAGCTGCTTTCCACTGGCTTCAAG
TGC
AAATTTCTGCACGACGGGCAGGAGTACACACTTCTGCTCATTGAGGCTTTCCCAGAGGATGCGGCAG
TC
TACACCTGTGAAGCCAAGAATGACTACGGAGTAGCCACAACGTCGGCTTCTCTGTCCGTGGAAGTTCC
A
GAAGTTGTATCTCCGGATCAGGAAATGCCAGTCTACCCGCCTGCCATAGTCACTCCACTTCAGGACACA
GTT
ACTTCTGAGGGGCGCCCAGCGCGTTTCCAGTGCCAAGTTTCAGGGACAGATTTGAAGGTGTCTTGGT
AC
TGCAAAGACAAGAAAATCAAACCATCTCGGTTCTTCAGGATGACCCAGTTTGAAGACACCTACCAGCT
G
GAGATCGCTGAAGCCTACCCCGAGGACGAGGGAACGTATGCCTTTGTTGCTAATAATGCTGTGGGCCAA
GTG
TCCAGCACTGCCACCCTGAGGCTGGAAGCCCCCGAGTCGATTCTGCATGAGAGGATCGGCCAGCAAA
TC
GAAATGGAGATGAAAGCTGCCCCTGTGATCAAAAGGAGAATTGAGCCCCTGGAAGTAGCTCTGGGCCA
C
CTGGCCAAATTCACCTGTGAGATCCAAGGAGCCCCCAACGTCCGGTTCCAGTGGTTCAAAGCTGGCAGA
GAG
ATCTATGAGAGCGACAAGTGTTCCATTCGATCTTCGAACTATGTCTCCAGCCTGGAGATCCTGAGAA
CC
CAGGTCGTTGACTGCGGGGAGTACACCTGCAAAGCCTCCAATGAGTATGGCAGTGTCAGCTGCACAGC
C
ACACTAACTGTGACAGAGGCGTATCCACCAACCTTTCTCTCCAGGCCCAAGGCCCTTACGACTTTCGTG
GGT
AAGGCAGCCAAGTTTCTCTGCACAGTGTCAGGGACTCCGGTGATTGAGATCATCTGGCAGAAAGATG
GC
GCTGCCCTGTCACCGTCACCTGACTGCAGGGTCACAGACGCAGACAACAAACACAGTTTAGAACTCTC
A
AATCTTACTGTTCAGGACAGGGGTATTTACTCTTGTAAGGCTTCCAACAAATTTGGAGCAGATATCTGC
CAG
GCCGAGTTGACCATCATTGACAAACCCCACTTCATTAAAGAGTTAGAGGCTGTACAGTCAGCCATCA
AT
AAGAAGATCCACCTTGAATGCCAAGTCGATGAGGATAGGAAAGTCACAATCACATGGAGCAAAGATGG
G
CAGAAACTTCCTGCTGGGAAAGATTACAAGATCTATTTTGAAGATAAAATAGCATCGCTTGAGATTCCC
CTG
GCCAAACTAAAAGATTCTGGAACCTATACATGTACAGCGTCCAACGAGGCTGGGAGCAGTTCTTCGT
CT
GCTGCGGTCGCTGTCAGAGAACCGCCGTCCTTTGTGAAGAAGGTGGATCCCTCTTATTTAATGCTCCC
G
GGTGAATCAGCACGCCTCCATTGCAAGCTGAAAGGCTCACCTGTGATCCAGGTCACTTGGTTCAAAAAT
AAC
AAAGAACTCAGTGAGAGTAACACAGTCCGCATGTCTTTTGTCAATTCTGAGGCTATCCTCGACATCA
CT
GATGTAAAGGTCGATGACAGTGGTACTTACTCCTGTGAAGCCACCAATGACGTGGGCAGCGACAGCTG
C
AGCACTGAAGTGGTGATCAAAGAGCCGCCTTCCTTCATCAAAACTCTTGAGCCCGCAGACATAGTGCGA
GGG
GCCAATGCACTGCTCCAGTGTGAGATCGCAGGCACGGGACCCTTTGAAGTTAACTGGTTTAAAGACA
AG
AAGCAGATCCGAAGTAGCAAAAAGTACAGGTTGTTTACTCAGAAGACTTTTGTGTACCTGGAAATCTC
A
TCTTTCAATAGTGCCGACGTTGGCGATTACGAATGTGTAGTTGCTAACGAAGTCGGAAAGTGTGGCTGT
GTC
GCGACACACTTATTAAAAGAACCACCAACCTTTGTCAAGAAAGTAGATGATTTTACAGCCCTAGCAG
GA
CAGACCGTTACCTTACAAGCTGCCGTGAGAGGGTCAGAACCCATTTCTGTCATGTGGATGAAAGGCCA
A
GAAGTCATTAAAGAAGATGGAAAAATCAAAATGAGCTTTTCCAATGGAGTTGCCGTCTTGACCATCCCT
GAT
GTTCAGATTAGTTTGGGTGGCAAATATACATGCCTGGCTGAAAACGAAGCTGGGAGCCAAACATCTG
TC
GGGGAATTGATAGTTAAAGAACCTGCCAAAATCATTGAGCGAGCAGAACTAATCCAGGTGACCGCAGG
A
GACCCAGCCACTCTGGAGTACACAGTCTCAGGCACCCCAGAACTCAAGCCCAAGTGGTACAAAGATGGG
AGA
CCCTTGGTTGCTAGTAAAAAGTACCGAATCAGTTTTAAAAACAACATTGCCCAACTGAAATTTTATT
CT
GCTGAACTGCACGACAGTGGCCAGTACACGTTTGAGATTTCCAACGAAGTGGGCAGCAGCTCCTGTGA
G
ACCACATTTACCGTGTTAGATCGAGACATTGCTCCGCTTTTCACCAAACCCTTACGTAACGTGGACAGT
GTC
GTTGGCGGTGCCTGCAGGTTAGACTGCAAAATTGCTGGCTCCCTCCCCATGAGGGTTTCCTGGTTTA
AG
GATGGCAAAGAGCTCACTGCTTCCGACAGATACCAGATAGCATTTGTGGAAGGCACAGCCTCTTTGGA
G
ATCAGCAGAGTAGACATGAATGATGCAGGGAATTTCACCTGCCGGGCCACCAATTCCGTGGGAAGCAAA
GAC
AGCAGCGGAGCCCTGATTGTGCAAGAACCACCCAGTTTTGTAACTAAGCCAGGGTCCAGGGATGTCC
TG
CCCGGCTCGGCAGTCTGTCTGAAGAGTGCTTTCCAGGGCTCCGCCCCTCTCACCATCAAGTGGTTTAA
G
GGCGACAAAGAGTTGGTTTCCGGTGGAAGCTGCTATATTACCAAAGAAACTTCAGAGAGTTCCCTGGAG
CTC
TACGCAGTGAAAACCTCGGATTCGGGCACTTACACGTGCAAAGTCAGCAACGTAGCCGGGAGTGTGG
AA
TGCAGTGCAGACTTGTTTGTGAAAGAGCCTGCTACCTTTATTGAAAAGTTAGAGCCATCCCAACTGTT
A
AAGAAAGGAGATGGCACTCAGCTAGCCTGCAAGGTCACGGGTACCCCTCCAATTAAGATAACATGGTTT
GCA
AATGACCGAGAACTGAGAGAGAGCAGCAAACACAAAATGTCTTTTGCGGAGTCCACCGCAGTTTTAA
GG
CTTACGGATGTGGCCATTGAAGACAGTGGAGAATATATGTGCGAGGCACAAAACGAGGCCGGCAGTGA
C
CACTGTACTGGCATTGTCATAGTCAAAGAGTCACCTTACTTTACCAAGGAATTTAAGTCCATTGAAGTA
TTA
AAGGAGTATGACGTCATGCTGCTGGCTGAGGTGGCAGGCACCCCTCCCTTTGAGATCACTTGGTTCA
AG
GACAACACAACCCTGAGAAGTGGTAGAAAGTATAAAACCTTCCTTCAGGATCAGCTGGTCAGCCTGCA
G
GTCCTCAAGTTTGTAGCTGCAGATGCAGGTGAATACCAATGCCGGGTGACCAACGAGGTCGGCAGCAGC
ACC
TGCAGTGCCAGGGTGACATTAAGAGAACCCCCGTCCTTCATTAAGAAGATTGAAGCCACCAGCTCCC
TC
CGTGGGGGCACAGCCGCCTTCCAGGCCACTCTGAAAGGCTCCTTGCCAATCACTGTGACCTGGTTGAA
A
GACAATGATGAGATCACTGAAGATGACAATATAAGAATGACTTTTGAGAACAACGTGGCTAGTCTATAC
CTC
AGTGGTATTGAAGTCAAGCATGATGGGAAATATGTCTGTCAAGCCAAAAATGATGCAGGCATACAAA
GG
TGTTCTGCATTACTCTCAGTCAAAGAACCTGCAACAATAATGGAGGAGGCTGTGTCCATAGATGTCAC
T
CAAGGAGACCCAGCCACTTTGCAAGTTAAATTTTCAGGGACTAAGGAGATTTCAGCTAAATGGTTTAAA
GAT
GGCCAAGAACTTACCCTGGGTCCAAAATACAAAATCAGTGTCACTGACACAGTCTCAATACTAAAGA
TT
ATTTCCACAGAGAAGAAGGATAGTGGAGAATATACTTTTGAGGTCCAAAACGATGTTGGGAGAAGCAG
C
TGCAAGGCTAGCATTAATGTTTTAGATCTTATTATACCTCCTTCATTCACCAAAAAATTGAGAAAAATG
GAC
AGCATTAAAGGATCTTTTATTGACTTAGAGTGTATAGTGGCTGGATCCCATCCAATAAGCATCCAAT
GG
TTCAAAGACGACCAAGAAATCTCAGCTAGTGACAAGCACAAATTCTCTTTTCATGACAATACCGCCTT
C
TTAGAGATCAGTCAGCTGGAAGGCACAGACAGTGGTACATATACCTGTTCTGCCACCAACAAGGCAGGC
CAC
AGCCAGTGCAGTGGTCACCTGACAGTCAAAGAACCCCCTTACTTCGTGGAAAAGCCACAGTCACAAG
AT
GTGAATCCCGGTACGAGGGTTCAATTGAAGGCTCTTGTGGGTGGCACTGCACCCATGACAATAAAGTG
G
TTTAAAGATAACAAGGAGCTGCACCCTGGGGCAGCTCGCTCGGTTTGGAAGGATGACACCTCCACCATT
CTT
GAACTCTTCTCAGCCAAGGCTGCCGACTCCGGGACCTACATTTGCCAGCTAAGCAATGATGTTGGCA
CA
ACAAGCAGCAAGGCCACCATCTTTGTGAAAGAACCTCCTCAATTTATTAAGAAGCCCAGTCCAGTGTT
A
GTGCTGAGGAATGGACAGTCAACAACATTTGAATGCCAAGTCACAGGCACCCCTGAAATCAGAGTTTCT
TGG
TATCTGGATGGGAATGAAATAACAGATCTTAGGAAATATGGCATTTCTTTTGTGGATGGTTTAGCCA
CT
TTCCAGATTTCTAATGCCAGGGTTGAAAACAGTGGAACTTACGTCTGTGAAGCTCGAAATGATGCAGG
C
ACCGCGAGCTGCAGCATTGAACTAAAAGTAAAAGAGCCTCCCATCTTTATCCGGGAGCTGGAGCCTGTG
GAA
GTGGTAAAAGACAGTGATGTGGAACTGGAGTGTGAAGTCATGGGGACAACTCCATTTGAAGTCACTT
GG
CTGAAGAATAACAAGGAAATCAGAAGTGGCAAAAAATACACAATGTCTGAGAAAATGTCAGTGTTTTA
C
CTGCATATAACCAAGTGTGACCCTTCAGACGTTGGTGAATATCAGTGCATCATAGCCAACGAAGGAGGC
AGC
TGTGCTTGTAGTGCTCGGGTTGCCTTGAAAGAACCACCATCGTTTATCAAGAAGATAGAAAATGTCA
CC
ACTGTCTTGAAGAGTTCCGCCACCTTTCAGAGCACCGTGGCAGGCTCACCGCCCATTTCTATAACCTG
G
CTAAAAGATGACCAGATTCTTGAGGAAAATGACAATGTCCATATTTCTTTTGAGGACAGTGTGGCCACA
CTT
CAAGTCCGGAGTGTGGACAATGGGCACAGTGGGCGATACACATGTCAAGCCAAGAATGAGTCAGGAA
TT
GAGAGGTGTTATGCTTTCCTCTTAGTACAAGAACCTGCTCAAATCATAGAGAAAGCTAAGTCGGTTGA
T
GTTACTGAGAAAGACCCAGTCACCCTGGAGTGCGTAGTGGCTGGAACACCAGAACTCAAAGTCAAATGG
CTT
AAAGATGGGAAACAAATTGTACCCAGTAGATATTTTTCAATGAGTTTTGAAAATAACGTGGCCAGTT
TT
AGGATTCAGTCAGTCATGAAGCAAGACAGTGGACAGTACACGTTCAAGGTGGAAAATGACTTTGGAAG
C
AGTAGCTGTGATGCCTACCTGAGAGTGCTAGACCAAGATATTCCCCCATCGTTCACCAAAAAGTTAACC
AAA
ATGGATAAAGTTCTGGGTTCTTCTATCCACATGGAGTGCAAGGTTTCTGGGTCACTTCCTATCAGTG
CT
CAGTGGTTTAAAGATGGAAAAGAGATATCTACAAGTGCAAAATACAGACTGGTGTGTCACGAAAACAC
C
GTGTCACTGGAAGTTAGTAATCTGGAA