Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information

SRX197996: Marine Mammal Run EB2
1 LS454 (454 GS FLX Titanium) run: 2,006 spots, 1.1M bases, 2.2Mb downloads

Accession: SRX197996
Experiment design: "DNA was extracted from samples derived from bottlenose dolphins and sealion, seawater, and fish food. The V3-V4-V5 region of the bacterial 16S rRNA gene was amplified using broad-range, barcoded primers. Equimolar amounts of the amplicons were pooled and sequenced on a 454 Titanium instrument."
Submitted by: Stanford University
Study summary: SRP016564 • Multiple body sites from marine mammals Targeted Locus (Loci) • PRJNA174530 • All experiments  • Run Selector (more...)(less...)
Abstract: Samples from sea lions and dolphins (oral, gastric, rectal) and seawater.
Center Project: uncultured bacterium
Sample: SAMN01162926 • Generic sample from Uncultured bacteria (more...)(less...)
Attributes:
19-Aug-2008
Tursiops truncatus
Dolphin_WD10
NA
Rectum
NA
CTACACAAGCAC
GCACTCCTACGGGAGGCAGCA
EB2
Library: EB2  (more...)(less...)
Strategy: AMPLICON
Source: GENOMIC
Selection: PCR
Layout: SINGLE
Platform: LS454  (more...)(less...)
Instrument model: 454 GS FLX Titanium
Spot descriptor:
         forward

Total: 1 run, 2,006 spots, 1.1M bases, 2.2Mb 
#Run# of Spots# of BasesSize
1. SRR5977122,0061.1M2.2Mb

ID:
261960

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk