Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 3

1.

rs1403635 [Homo sapiens]
    AGCCAGGAACTTTTATAGGTTCTTA[C/T]TTTATTGCACTGAAGAAACCAGTCT
    Chromosome:
    3:2248114
    Gene:
    CNTN4 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.1901/952
    HGVS:
    NC_000003.11:g.2289798G>A, NC_000003.12:g.2248114G>A, NG_012827.1:g.152552G>A, NM_001206955.1:c.-145+9046G>A, NM_175607.2:c.-144-91064G>A, XM_005264903.1:c.-144-91064G>A, XM_005264904.1:c.-145+80763G>A, XM_005264906.1:c.-144-91064G>A, XM_011533425.1:c.-144-91064G>A, XM_011533426.1:c.-144-91064G>A, XM_011533427.1:c.-144-91064G>A
    2.

    rs56580043 has merged into rs1403635 [Homo sapiens]
      AGCCAGGAACTTTTATAGGTTCTTA[C/T]TTTATTGCACTGAAGAAACCAGTCT
      Chromosome:
      3:2248114
      Gene:
      CNTN4 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.1901/952
      HGVS:
      NC_000003.11:g.2289798G>A, NC_000003.12:g.2248114G>A, NG_012827.1:g.152552G>A, NM_001206955.1:c.-145+9046G>A, NM_175607.2:c.-144-91064G>A, XM_005264903.1:c.-144-91064G>A, XM_005264904.1:c.-145+80763G>A, XM_005264906.1:c.-144-91064G>A, XM_011533425.1:c.-144-91064G>A, XM_011533426.1:c.-144-91064G>A, XM_011533427.1:c.-144-91064G>A
      3.

      rs59634736 has merged into rs1403635 [Homo sapiens]
        AGCCAGGAACTTTTATAGGTTCTTA[C/T]TTTATTGCACTGAAGAAACCAGTCT
        Chromosome:
        3:2248114
        Gene:
        CNTN4 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.1901/952
        HGVS:
        NC_000003.11:g.2289798G>A, NC_000003.12:g.2248114G>A, NG_012827.1:g.152552G>A, NM_001206955.1:c.-145+9046G>A, NM_175607.2:c.-144-91064G>A, XM_005264903.1:c.-144-91064G>A, XM_005264904.1:c.-145+80763G>A, XM_005264906.1:c.-144-91064G>A, XM_011533425.1:c.-144-91064G>A, XM_011533426.1:c.-144-91064G>A, XM_011533427.1:c.-144-91064G>A

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Search details

        See more...

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Write to the Help Desk