Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs133291 [Homo sapiens]
    TGAAGGGAGGTAGTAACCAAGGTTC[C/T]GTGGCTCCTGAGACTTCTTGGGGCC
    Chromosome:
    22:41873624
    Gene:
    SREBF2 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    T=0.2556/1280
    HGVS:
    NC_000022.10:g.42269628C>T, NC_000022.11:g.41873624C>T, NM_004599.3:c.868-174C>T, NR_103834.1:n.1060-174C>T, XM_006724310.1:c.778-174C>T, XM_011530347.1:c.868-174C>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center