Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 8

2.

rs5743266 has merged into rs2076752 [Homo sapiens]
    AGTCCTGTGCCACTGGGCTTTTGGC[A/G]TTCTGCACAAGGCCTACCCGCAGAT
    Chromosome:
    16:50697185
    Gene:
    NOD2 (GeneView)
    Functional Consequence:
    intron variant,utr variant 5 prime
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.1410/706
    HGVS:
    NC_000016.10:g.50697185G>A, NC_000016.9:g.50731096G>A, NG_007508.1:g.5047G>A, NM_022162.1:c.-59G>A, NM_022162.2:c.-59G>A, XM_005256084.1:c.-8-2303G>A, XM_005256084.2:c.-8-2303G>A, XM_006721242.2:c.-8-2303G>A, XM_006721243.2:c.-8-2303G>A, XM_011523258.1:c.-38+3523G>A, XM_011523260.1:c.-8-2303G>A, XM_011523261.1:c.-8-2303G>A, XR_429725.2:n.83-2303G>A, XR_429726.2:n.83-2303G>A, XR_933387.1:n.83-2303G>A
    4.

    rs2076753 [Homo sapiens]
      TGCATCTGGCTTCTGGAGAAGTCCC[G/T]CACTGACCTTGTTCTCCTCCCCAGG
      Chromosome:
      16:50699463
      Gene:
      NOD2 (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB,utr variant 5 prime
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1156/579
      HGVS:
      NC_000016.10:g.50699463G>T, NC_000016.9:g.50733374G>T, NG_007508.1:g.7325G>T, NM_001293557.1:c.-33G>T, NM_022162.1:c.74-25G>T, NM_022162.2:c.74-25G>T, XM_005256084.1:c.-8-25G>T, XM_005256084.2:c.-8-25G>T, XM_006721242.2:c.-8-25G>T, XM_006721243.2:c.-8-25G>T, XM_011523257.1:c.-529G>T, XM_011523258.1:c.-38+5801G>T, XM_011523259.1:c.-512G>T, XM_011523260.1:c.-8-25G>T, XM_011523261.1:c.-8-25G>T, XR_429725.2:n.83-25G>T, XR_429726.2:n.83-25G>T, XR_933387.1:n.83-25G>T

      Display Settings:

      Format
      Items per page
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Write to the Help Desk