Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 5

1.

rs9439519 [Homo sapiens]
    TTCCTGGGACACTCATGTGCAAGCT[C/T]CTGGGAAAGTAGGAAAATGTGCAAT
    Chromosome:
    1:5304574
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.3648/1827
    HGVS:
    NC_000001.10:g.5364634C>T, NC_000001.11:g.5304574C>T
    2.

    rs4809957 [Homo sapiens]
      GCAAGACAGAACAGGCTCCCAGGCC[A/G]TTCTAAGCACCTGAAGATGGTGCTG
      Chromosome:
      20:54154632
      Gene:
      CYP24A1 (GeneView)
      Functional Consequence:
      utr variant 3 prime
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.3966/1986
      HGVS:
      NC_000020.10:g.52771171A>G, NC_000020.11:g.54154632A>G, NG_008334.1:g.24346T>C, NM_000782.4:c.*140T>C, NM_001128915.1:c.*140T>C, XM_005260304.1:c.*312T>C, XM_005260304.3:c.*312T>C, XM_005260305.1:c.*140T>C
      3.

      rs2895680 [Homo sapiens]
        aaaactaatcatagtttactacaac[C/T]caattgagcctaccatttctgtatt
        Chromosome:
        5:147264552
        Gene:
        STK32A (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.2426/1215
        HGVS:
        NC_000005.10:g.147264552C>T, NC_000005.9:g.146644115C>T, NM_001112724.1:c.53-13572C>T, NM_001287740.1:c.53-13572C>T, NM_145001.3:c.53-13572C>T, XM_005268385.1:c.53-13572C>T, XM_011537577.1:c.53-13572C>T, XM_011537578.1:c.53-13572C>T, XM_011537579.1:c.53-13572C>T
        4.

        rs1663689 [Homo sapiens]
          GCTAATATTATTTGAAAGCCCAGTA[A/G]AGGAGAGTGAGGATGAGAAAAGAAA
          Chromosome:
          10:8983232
          Gene:
          LOC105376400 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.3105/1555
          HGVS:
          NC_000010.10:g.9025195T>C, NC_000010.11:g.8983232T>C, XR_930641.1:n.32+82131A>G
          5.

          rs247008 [Homo sapiens]
            CTCTGAAGGTAGGAGTGGGAAGTCT[C/T]GCATTGGAAAGGCCTTCTTAGGTGC
            Chromosome:
            5:132111411
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            A=0.4623/2315
            HGVS:
            NC_000005.10:g.132111411A>G, NC_000005.9:g.131447104A>G

            Display Settings:

            Format
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Write to the Help Desk