Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 10

7.

rs281875327 [Homo sapiens]
    GAGCGAGGCTACAGCTTCACCACCA[A/C]GGCCGAGCGGGAAATCGTGCGCGAC
    Chromosome:
    17:81511382
    Gene:
    ACTG1 (GeneView) FSCN2 (GeneView)
    Functional Consequence:
    missense,nc transcript variant,upstream variant 2KB
    Allele Origin:
    A(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    no info
    HGVS:
    NC_000017.10:g.79478408G>T, NC_000017.11:g.81511382G>T, NG_011433.1:g.6420C>A, NM_001199954.1:c.608C>A, NM_001614.3:c.608C>A, NP_001186883.1:p.Thr203Lys, NP_001605.1:p.Thr203Lys, NR_037688.1:n.747C>A, NW_003871087.1:g.166020G>T, XM_005257195.3:c.-4314G>T
    8.

    rs281875326 [Homo sapiens]
      CGCACCACTGGCATTGTCATGGACT[C/T]TGGAGACGGGGTCACCCACACGGTG
      Chromosome:
      17:81511526
      Gene:
      ACTG1 (GeneView) FSCN2 (GeneView)
      Functional Consequence:
      missense,nc transcript variant,upstream variant 2KB
      Allele Origin:
      T(germline)/C(germline)
      Clinical significance:
      Pathogenic
      Validated:
      no info
      HGVS:
      NC_000017.10:g.79478552G>A, NC_000017.11:g.81511526G>A, NG_011433.1:g.6276C>T, NM_001199954.1:c.464C>T, NM_001614.3:c.464C>T, NP_001186883.1:p.Ser155Phe, NP_001605.1:p.Ser155Phe, NR_037688.1:n.603C>T, NW_003871087.1:g.166164G>A, XM_005257195.3:c.-4170G>A
      9.

      rs281875325 [Homo sapiens]
        CCCAAGGCCAACAGAGAGAAGATGA[C/T]TCAGGTGAGGCTCGGCCGACGCCCG
        Chromosome:
        17:81511907
        Gene:
        ACTG1 (GeneView) FSCN2 (GeneView)
        Functional Consequence:
        missense,nc transcript variant,upstream variant 2KB
        Allele Origin:
        T(germline)/C(germline)
        Clinical significance:
        Pathogenic
        Validated:
        no info
        HGVS:
        NC_000017.10:g.79478933G>A, NC_000017.11:g.81511907G>A, NG_011433.1:g.5895C>T, NM_001199954.1:c.359C>T, NM_001614.3:c.359C>T, NP_001186883.1:p.Thr120Ile, NP_001605.1:p.Thr120Ile, NR_037688.1:n.498C>T, NW_003871087.1:g.166545G>A, XM_005257195.3:c.-3789G>A
        10.

        rs11549190 [Homo sapiens]
          TTCAACACCCCGGCCATGTACGTGG[C/T]CATCCAGGCCGTGCTGTCCCTCTAC
          Chromosome:
          17:81511586
          Gene:
          ACTG1 (GeneView) FSCN2 (GeneView)
          Functional Consequence:
          missense,nc transcript variant,upstream variant 2KB
          Allele Origin:
          T(germline)/C(germline)
          Clinical significance:
          Pathogenic
          Validated:
          by cluster
          HGVS:
          NC_000017.10:g.79478612G>A, NC_000017.11:g.81511586G>A, NG_011433.1:g.6216C>T, NM_001199954.1:c.404C>T, NM_001614.3:c.404C>T, NP_001186883.1:p.Ala135Val, NP_001605.1:p.Ala135Val, NR_037688.1:n.543C>T, NW_003871087.1:g.166224G>A, XM_005257195.3:c.-4110G>A

          Display Settings:

          Format
          Items per page
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Write to the Help Desk