Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 34

1.

rs73377792 [Homo sapiens]
    AATAAAAATGAATGGTGTCTGACAC[A/G]TGCTAAAACATGAATAACCTTTGGA
    Chromosome:
    15:28092063
    Gene:
    OCA2 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    Global MAF:
    G=0.0689/345
    HGVS:
    NC_000015.10:g.28092063A>G, NC_000015.9:g.28337209A>G, NG_009846.1:g.12250T>C, NM_000275.2:c.-22+7161T>C, NM_001300984.1:c.-22+7161T>C, NT_187660.1:g.226363A>G, NW_011332701.1:g.226363A>G, XM_005268259.1:c.-22+7161T>C, XM_011521640.1:c.-22+7161T>C
    2.

    rs17305573 [Homo sapiens]
      GAACAGAATTTGTTAAAACAGAAAA[C/T]AAAGGTACAATATAAGGAATCAACA
      Chromosome:
      20:34592348
      Gene:
      PIGU (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.0142/71
      HGVS:
      NC_000020.10:g.33180152T>C, NC_000020.11:g.34592348T>C, NG_011497.1:g.89938A>G, NM_080476.4:c.628-3741A>G, XM_005260279.1:c.628-3741A>G, XM_005260280.1:c.568-3741A>G, XM_011528542.1:c.-21-3741A>G
      4.

      rs12913832 [Homo sapiens]
        GAGGCCAGTTTCATTTGAGCATTAA[A/G]TGTCAAGTTCTGCACGCTATCATCA
        Chromosome:
        15:28120472
        Gene:
        HERC2 (GeneView)
        Functional Consequence:
        intron variant
        Allele Origin:
        G(germline)/A(germline)
        Clinical significance:
        other
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.1773/888
        HGVS:
        NC_000015.10:g.28120472A, NC_000015.10:g.28120472A>G, NC_000015.9:g.28365618A>G, NG_016355.1:g.206678T, NG_016355.1:g.206678T>C, NM_004667.5:c.13272+874C>T, NM_004667.5:c.13272+874T>C, NT_187660.1:g.253911G, NT_187660.1:g.253911G>A, NW_011332701.1:g.253911G, NW_011332701.1:g.253911G>A, XM_005268275.1:c.13257+874T>C, XM_005268276.1:c.13158+874T>C, XM_005268276.3:c.13158+874C>T, XM_005268276.3:c.13158+874T>C, XM_005268277.1:c.13158+874T>C, XM_005268277.3:c.13158+874C>T, XM_005268277.3:c.13158+874T>C, XM_005268278.1:c.13014+874T>C, XM_005268279.1:c.10788+874T>C, XM_005268280.1:c.6438+874T>C, XM_005268281.1:c.6438+874T>C, XM_006720726.2:c.13257+874C>T, XM_006720726.2:c.13257+874T>C, XM_006720727.2:c.13014+874C>T, XM_006720727.2:c.13014+874T>C, XM_011522131.1:c.12789+874C>T, XM_011522131.1:c.12789+874T>C, XM_011522132.1:c.10788+874C>T, XM_011522132.1:c.10788+874T>C, XM_011522133.1:c.10017+874C>T, XM_011522133.1:c.10017+874T>C, XM_011522134.1:c.7389+874C>T, XM_011522134.1:c.7389+874T>C, XM_011548956.1:c.13257+874C>T, XM_011548956.1:c.13257+874T>C, XM_011548957.1:c.13158+874C>T, XM_011548957.1:c.13158+874T>C, XM_011548958.1:c.13158+874C>T, XM_011548958.1:c.13158+874T>C, XM_011548959.1:c.13014+874C>T, XM_011548959.1:c.13014+874T>C, XM_011548960.1:c.12789+874C>T, XM_011548960.1:c.12789+874T>C, XM_011548961.1:c.10788+874C>T, XM_011548961.1:c.10788+874T>C, XM_011548962.1:c.10017+874C>T, XM_011548962.1:c.10017+874T>C, XM_011548963.1:c.7389+874C>T, XM_011548963.1:c.7389+874T>C
        5.

        rs12896399 [Homo sapiens]
          GTTCTTTAGGTCAGTATATTTTGGG[G/T]TCTCTTTGTCACAGCAGATTAACCT
          Chromosome:
          14:92307319
          Gene:
          LOC105370627 (GeneView)
          Functional Consequence:
          intron variant
          Allele Origin:
          G(germline)/T(germline)
          Clinical significance:
          other
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2608/1306
          HGVS:
          NC_000014.8:g.92773663G>T, NC_000014.9:g.92307319G>T, XR_944153.1:n.131+2775G>T
          6.

          rs11204756 [Homo sapiens]
            AGTGGCGTGATCTCAGCTCACTGCA[A/G]CCTTCACCTTCTGGGTTCAAGTGAT
            Chromosome:
            1:150990447
            Gene:
            ANXA9 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency
            Global MAF:
            G=0.2907/1456
            HGVS:
            NC_000001.10:g.150962923G>A, NC_000001.11:g.150990447G>A, NM_003568.2:c.852+2106G>A, XM_005245539.1:c.852+2106G>A, XM_005245539.3:c.852+2106G>A, XM_005245540.1:c.852+2106G>A, XM_005245542.1:c.*22+2106G>A, XM_011510058.1:c.852+2106G>A, XR_241100.1:n.991+2106G>A
            7.

            rs10830253 [Homo sapiens]
              AGCTAACATTTAATTGAGTACACAC[G/T]ATATACCAGGCCCTGAATCACTTAC
              Chromosome:
              11:89294875
              Gene:
              TYR (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.2242/1123
              HGVS:
              NC_000011.10:g.89294875T>G, NC_000011.9:g.89028043T>G, NG_008748.1:g.122004T>G, NM_000372.4:c.1367-268T>G, XM_011542970.1:c.*45-268T>G
              8.

              rs10757257 [Homo sapiens]
                AGGGAGGAAGCCACCTGGAGTGAGA[A/G]TAATTCAAGCAATCTTTTTTGTGGT
                Chromosome:
                9:21806565
                Gene:
                MTAP (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.3171/1588
                HGVS:
                NC_000009.11:g.21806564G>A, NC_000009.12:g.21806565G>A, NG_032650.1:g.8930G>A, NM_002451.3:c.33+3784G>A, XM_005251463.1:c.33+3784G>A, XM_005251464.1:c.33+3784G>A, XM_005251465.1:c.84+3615G>A, XM_005251466.1:c.84+3615G>A, XR_242508.1:n.140+3784G>A
                9.

                rs7412746 [Homo sapiens]
                  CATAAACCAATAGCTTCACACCACA[C/T]CTCCTTTCTCCTACTATAATCCCAA
                  Chromosome:
                  1:150887995
                  Gene:
                  LOC100996521 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.3131/1568
                  HGVS:
                  NC_000001.10:g.150860471C>T, NC_000001.11:g.150887995C>T, XR_158744.2:n.96+682C>T, XR_158744.3:n.61+682C>T, XR_241119.1:n.41+122C>T
                  10.

                  rs7023329 [Homo sapiens]
                    TGGTAACCTTGAGTCCTGTGAATCT[A/G]TGCCTGCAGAGGGATCAATAAGTAA
                    Chromosome:
                    9:21816529
                    Gene:
                    MTAP (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.4499/2253
                    HGVS:
                    NC_000009.11:g.21816528A>G, NC_000009.12:g.21816529A>G, NG_032650.1:g.18894A>G, NM_002451.3:c.121-185A>G, XM_005251463.1:c.121-185A>G, XM_005251464.1:c.121-185A>G, XM_005251465.1:c.172-185A>G, XM_005251466.1:c.172-185A>G, XR_242508.1:n.228-185A>G
                    13.

                    rs4911414 [Homo sapiens]
                      gtaagtctttgctgagaaattcatt[G/T]ttagtctaatatgatgcttttctct
                      Chromosome:
                      20:34141638
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.2023/1013
                      HGVS:
                      NC_000020.10:g.32729444T>G, NC_000020.11:g.34141638T>G
                      14.

                      rs4778138 [Homo sapiens]
                        gtgaaaatataacatatcaaaattg[A/G]cagaacacagctaaatcagtgatgg
                        Chromosome:
                        15:28090674
                        Gene:
                        OCA2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.4976/2492
                        HGVS:
                        NC_000015.10:g.28090674A>G, NC_000015.9:g.28335820A>G, NG_009846.1:g.13639T>C, NM_000275.2:c.-22+8550T>C, NM_001300984.1:c.-22+8550T>C, NT_187660.1:g.224974A>G, NW_011332701.1:g.224974A>G, XM_005268259.1:c.-22+8550T>C, XM_011521640.1:c.-22+8550T>C
                        16.

                        rs2218220 [Homo sapiens]
                          CAACCTTCTTTGCACATTAGCACCC[C/T]TGGGATTTGGCATGATCCTATCAGT
                          Chromosome:
                          9:21756090
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          C=0.3914/1960
                          HGVS:
                          NC_000009.11:g.21756089C>T, NC_000009.12:g.21756090C>T
                          17.
                          18.

                          rs1847142 [Homo sapiens]
                            CTTTAACCCCTACATTGTCTTCTAC[A/G]CATATGCTCCACCTCTTTGTTCCTT
                            Chromosome:
                            11:89288406
                            Gene:
                            TYR (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            A=0.1931/967
                            HGVS:
                            NC_000011.10:g.89288406G>A, NC_000011.9:g.89021574G>A, NG_008748.1:g.115535G>A, NM_000372.4:c.1366+3452G>A, XM_011542970.1:c.1367-32G>A
                            19.

                            rs1806319 [Homo sapiens]
                              CAGTGTCACCATGTTTACCAGTTTG[A/G]GTTCTGTATTTCCTTTTAGTTGAAG
                              Chromosome:
                              11:89304768
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              C=0.3866/1936
                              HGVS:
                              NC_000011.10:g.89304768T>C, NC_000011.9:g.89037936T>C
                              20.

                              rs1805008 [Homo sapiens]
                                CTACCACAGCATCGTGACCCTGCCG[C/T]GGGCGCGGCGAGCCGTTGCGGCCAT
                                Chromosome:
                                16:89919736
                                Gene:
                                MC1R (GeneView)
                                Functional Consequence:
                                missense
                                Allele Origin:
                                T(germline)/C(germline)
                                Clinical significance:
                                other
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.0146/73
                                HGVS:
                                NC_000016.10:g.89919736C>T, NC_000016.9:g.89986144C>T, NG_012026.1:g.6858C>T, NG_027810.1:g.2728C>T, NM_002386.3:c.478C>T, NP_002377.4:p.Arg160Trp

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Write to the Help Desk