Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 14

2.
3.

rs12566888 [Homo sapiens]
    TAGGACTAGAAGCTTTGTACTCCAG[G/T]ATAGGAAGTGATGAGAGAGAGAGGG
    Chromosome:
    1:156899255
    Gene:
    PEAR1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.3932/1969
    HGVS:
    NC_000001.10:g.156869047G>T, NC_000001.11:g.156899255G>T, NM_001080471.1:c.-9-4663G>T, XM_005245141.1:c.-168-2933G>T, XM_005245141.2:c.-168-2933G>T, XM_006711302.2:c.-168-2933G>T, XM_011509508.1:c.-164-2933G>T, XM_011509509.1:c.-107-2933G>T, XM_011509510.1:c.-107-2933G>T, XM_011509511.1:c.-168-2933G>T, XM_011509512.1:c.-494-4663G>T
    4.

    rs12564129 [Homo sapiens]
      ACTTTGTACCCTTGAAGGGTGTTTC[C/T]GAGGACACAAATCCTCGTAGACCCT
      Chromosome:
      1:156886003
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.2412/1208
      HGVS:
      NC_000001.10:g.156855795T>C, NC_000001.11:g.156886003T>C
      5.

      rs12407092 [Homo sapiens]
        ACGGAGCAGGCTCTAGTCTGAGGTC[C/T]GAGGTCTGAGGTTCTGTTCCAGAAT
        Chromosome:
        1:156899056
        Gene:
        PEAR1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.1713/858
        HGVS:
        NC_000001.10:g.156868848T>C, NC_000001.11:g.156899056T>C, NM_001080471.1:c.-9-4862T>C, XM_005245141.1:c.-168-3132T>C, XM_005245141.2:c.-168-3132T>C, XM_006711302.2:c.-168-3132T>C, XM_011509508.1:c.-164-3132T>C, XM_011509509.1:c.-107-3132T>C, XM_011509510.1:c.-107-3132T>C, XM_011509511.1:c.-168-3132T>C, XM_011509512.1:c.-494-4862T>C
        6.

        rs12041331 [Homo sapiens]
          AAGTCCCTTCTGCTGTCTCACTTCC[A/G]TCACCCTTACTCTCTGCTTTCTATA
          Chromosome:
          1:156899922
          Gene:
          PEAR1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.3345/1675
          HGVS:
          NC_000001.10:g.156869714G>A, NC_000001.11:g.156899922G>A, NM_001080471.1:c.-9-3996G>A, XM_005245141.1:c.-168-2266G>A, XM_005245141.2:c.-168-2266G>A, XM_006711302.2:c.-168-2266G>A, XM_011509508.1:c.-164-2266G>A, XM_011509509.1:c.-107-2266G>A, XM_011509510.1:c.-107-2266G>A, XM_011509511.1:c.-168-2266G>A, XM_011509512.1:c.-494-3996G>A
          7.

          rs11264579 [Homo sapiens]
            GGCACCTGAACTAGACCTTGAAAGA[C/T]GGGAACTCCAGGTGAAGAATGAGAC
            Chromosome:
            1:156903671
            Gene:
            PEAR1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.4309/2158
            HGVS:
            NC_000001.10:g.156873463T>C, NC_000001.11:g.156903671T>C, NM_001080471.1:c.-9-247T>C, XM_005245141.1:c.-70-186T>C, XM_005245141.2:c.-70-186T>C, XM_005245142.1:c.-1314T>C, XM_006711302.2:c.-70-186T>C, XM_011509508.1:c.-66-190T>C, XM_011509509.1:c.-9-247T>C, XM_011509510.1:c.-9-247T>C, XM_011509511.1:c.-70-186T>C, XM_011509512.1:c.-494-247T>C
            8.

            rs4661012 [Homo sapiens]
              CAGGGTGCCAGGCACTTCTTTAATG[G/T]GTTCTTTCTTTATGTGATTATTTGA
              Chromosome:
              1:156915699
              Gene:
              PEAR1 (GeneView)
              Functional Consequence:
              utr variant 3 prime
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.4451/2229
              HGVS:
              NC_000001.10:g.156885491T>G, NC_000001.11:g.156915699T>G, NM_001080471.1:c.*901T>G, XM_005245141.1:c.*901T>G, XM_005245141.2:c.*901T>G, XM_005245142.1:c.*901T>G, XM_006711302.2:c.*901T>G, XM_011509508.1:c.*901T>G, XM_011509509.1:c.*901T>G, XM_011509510.1:c.*901T>G, XM_011509511.1:c.*901T>G, XM_011509512.1:c.*901T>G
              10.

              rs2768759 [Homo sapiens]
                CCCTATCACTTCCAATCACCTGTCC[A/C]GTTCCTGCAATAATGCAAGCTTCCC
                Chromosome:
                1:156882671
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency
                Global MAF:
                C=0.3233/1619
                HGVS:
                NC_000001.10:g.156852463A>C, NC_000001.11:g.156882671A>C, NG_007493.1:g.71922A>C
                11.

                rs2644604 [Homo sapiens]
                  CTTCCTAGAGGAAGGGACACCTAAA[C/T]TGAGACTCAAGTCCTGAAGCCATTC
                  Chromosome:
                  1:156878314
                  Gene:
                  NTRK1 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.3580/1793
                  HGVS:
                  NC_000001.10:g.156848106A>G, NC_000001.11:g.156878314A>G, NG_007493.1:g.67565A>G, NM_001007792.1:c.1698-808A>G, NM_001012331.1:c.1788-808A>G, NM_002529.3:c.1806-808A>G, XM_005245219.1:c.1875-808A>G
                  12.

                  rs1204331 [Homo sapiens]
                    TTGTTGATGTCAAATAAATGGTATT[A/G]GCTATAGTCAGGAAAAAGAGCTTAA
                    Chromosome:
                    6:71733666
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.3127/1566
                    HGVS:
                    NC_000006.11:g.72443369G>A, NC_000006.12:g.71733666G>A
                    14.

                    rs499869 [Homo sapiens]
                      cgtggggtggcgggaggagggaggg[A/T]tagcattaggagatatacctaatgt
                      Chromosome:
                      1:85442168
                      Gene:
                      DDAH1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.1571/787
                      HGVS:
                      NC_000001.10:g.85907851A>T, NC_000001.11:g.85442168A>T, NM_001134445.1:c.-7+53998T>A, NM_012137.3:c.303+22575T>A, XM_005270706.1:c.24+22328T>A, XM_005270707.1:c.19-83321T>A, XM_005270707.2:c.19-83321T>A, XM_005270709.1:c.-7+53998T>A, XM_005270709.2:c.-7+53998T>A, XM_011541158.1:c.-87+53998T>A

                      Display Settings:

                      Format
                      Items per page
                      Sort by

                      Send to:

                      Choose Destination

                      Supplemental Content

                      Find related data

                      Recent activity

                      Your browsing activity is empty.

                      Activity recording is turned off.

                      Turn recording back on

                      See more...
                      Write to the Help Desk