Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 29

4.

rs7769979 [Homo sapiens]
    TATATTTGAAACATCAGTCACTATA[A/G]TTGTCCCCAAACAATTCCACCATGC
    Chromosome:
    6:32755795
    Gene:
    HLA-DQB2 (GeneView)
    Functional Consequence:
    downstream variant 500B
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4251/2129
    HGVS:
    NC_000006.11:g.32723572G, NC_000006.11:g.32723572G>A, NC_000006.12:g.32755795G, NC_000006.12:g.32755795G>A, NM_001198858.1:c.*658C>T, NM_001198858.1:c.*658T>C, NM_001300790.1:c.*658C>T, NM_001300790.1:c.*658T>C, NT_113891.3:g.4169368G, NT_113891.3:g.4169368G>A, NT_167244.2:g.4061934G, NT_167244.2:g.4061934G>A, NT_167245.2:g.4000551A, NT_167245.2:g.4000551A>G, NT_167246.2:g.4175147G, NT_167246.2:g.4175147G>A, NT_167247.2:g.4055170A, NT_167247.2:g.4055170A>G, NT_167248.2:g.3950096G, NT_167248.2:g.3950096G>A, NT_167249.2:g.4155940G, NT_167249.2:g.4155940G>A, XM_005249051.1:c.*1439C>T, XM_005249051.1:c.*1439T>C, XM_005272807.1:c.*1440C>T, XM_005272807.1:c.*1440T>C, XM_005274855.1:c.*1440C>T, XM_005274855.1:c.*1440T>C, XM_005274955.1:c.*1441C>T, XM_005274955.1:c.*1441T>C, XM_005275111.1:c.*1441C>T, XM_005275111.1:c.*1441T>C, XM_005275245.1:c.*1441C>T, XM_005275245.1:c.*1441T>C, XM_005275386.1:c.*1441C>T, XM_005275386.1:c.*1441T>C, XM_005275546.1:c.*1439C>T, XM_005275546.1:c.*1439T>C, XM_011514560.1:c.*658C>T, XM_011514560.1:c.*658T>C, XM_011514561.1:c.*658C>T, XM_011514561.1:c.*658T>C, XM_011546309.1:c.*658C>T, XM_011546309.1:c.*658T>C, XM_011546310.1:c.*658C>T, XM_011546310.1:c.*658T>C, XM_011547242.1:c.*658C>T, XM_011547242.1:c.*658T>C, XM_011547243.1:c.*658C>T, XM_011547243.1:c.*658T>C, XM_011547646.1:c.*658C>T, XM_011547646.1:c.*658T>C, XM_011547647.1:c.*658C>T, XM_011547647.1:c.*658T>C, XM_011547877.1:c.*658C>T, XM_011547877.1:c.*658T>C, XM_011547878.1:c.*658C>T, XM_011547878.1:c.*658T>C, XM_011548045.1:c.*658C>T, XM_011548045.1:c.*658T>C, XM_011548046.1:c.*658C>T, XM_011548046.1:c.*658T>C, XM_011548233.1:c.*658C>T, XM_011548233.1:c.*658T>C, XM_011548234.1:c.*658C>T, XM_011548234.1:c.*658T>C, XM_011548425.1:c.*658C>T, XM_011548425.1:c.*658T>C, XM_011548426.1:c.*658C>T, XM_011548426.1:c.*658T>C
    6.

    rs6916394 [Homo sapiens]
      ttcatatgccacacataatttatcg[C/T]tttaaagtgtacagatcagtggctt
      Chromosome:
      6:31496273
      Gene:
      LOC102725068 (GeneView) MICB (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.3754/1880
      HGVS:
      NC_000006.11:g.31464050T, NC_000006.11:g.31464050T>C, NC_000006.12:g.31496273T, NC_000006.12:g.31496273T>C, NG_021405.1:g.3196T, NG_021405.1:g.3196T>C, NM_001289160.1:c.-27+1278C>T, NM_001289160.1:c.-27+1278T>C, NM_001289161.1:c.-1921C>T, NM_001289161.1:c.-1921T>C, NM_005931.4:c.-1921C>T, NM_005931.4:c.-1921T>C, NT_113891.3:g.2973619T, NT_113891.3:g.2973619T>C, NT_167244.1:g.2778757T, NT_167244.1:g.2778757T>C, NT_167244.2:g.2828841T, NT_167244.2:g.2828841T>C, NT_167245.2:g.2743884T, NT_167245.2:g.2743884T>C, NT_167247.2:g.2838233T, NT_167247.2:g.2838233T>C, NT_167248.2:g.2752171C, NT_167248.2:g.2752171C>T, NT_167249.2:g.2795567C, NT_167249.2:g.2795567C>T, XM_005249125.1:c.-27+1278C>T, XM_005249125.1:c.-27+1278T>C, XM_005249126.1:c.-1921C>T, XM_005249126.1:c.-1921T>C, XM_005272818.1:c.-27+1283C>T, XM_005272818.1:c.-27+1283T>C, XM_005272819.1:c.-1915C>T, XM_005272819.1:c.-1915T>C, XM_005274863.1:c.-27+1278C>T, XM_005274863.1:c.-27+1278T>C, XM_005274864.1:c.-1921C>T, XM_005274864.1:c.-1921T>C, XM_005274975.1:c.-27+1297C>T, XM_005274975.1:c.-27+1297T>C, XM_005274976.1:c.-1918C>T, XM_005274976.1:c.-1918T>C, XM_005275250.1:c.-27+1283C>T, XM_005275250.1:c.-27+1283T>C, XM_005275251.1:c.-1915C>T, XM_005275251.1:c.-1915T>C, XM_005275408.1:c.-27+1283C>T, XM_005275408.1:c.-27+1283T>C, XM_005275409.1:c.-1923C>T, XM_005275409.1:c.-1923T>C, XM_005275556.1:c.-27+1283C>T, XM_005275556.1:c.-27+1283T>C, XM_005275557.1:c.-1922C>T, XM_005275557.1:c.-1922T>C, XM_006726002.2:c.-656C>T, XM_006726002.2:c.-656T>C, XM_006726095.2:c.-655C>T, XM_006726095.2:c.-655T>C, XM_011514630.1:c.-27+1297C>T, XM_011514630.1:c.-27+1297T>C, XM_011514631.1:c.-654C>T, XM_011514631.1:c.-654T>C, XM_011546312.1:c.-27+1297C>T, XM_011546312.1:c.-27+1297T>C, XM_011546313.1:c.-654C>T, XM_011546313.1:c.-654T>C, XM_011547251.1:c.-27+1302C>T, XM_011547251.1:c.-27+1302T>C, XM_011547252.1:c.-650C>T, XM_011547252.1:c.-650T>C, XM_011547655.1:c.-651C>T, XM_011547655.1:c.-651T>C, XM_011547656.1:c.-27+1297C>T, XM_011547656.1:c.-27+1297T>C, XM_011548052.1:c.-27+1302C>T, XM_011548052.1:c.-27+1302T>C, XM_011548053.1:c.-650C>T, XM_011548053.1:c.-650T>C, XR_926693.1:n.-1479A>G, XR_926693.1:n.-1479G>A, XR_953042.1:n.-1666A>G, XR_953042.1:n.-1666G>A
      8.

      rs3828903 [Homo sapiens]
        TGGGGAAATGTCACCAGAGAAATGG[A/G]GGTGGTGCCAGACAATAGATTGTGG
        Chromosome:
        6:31496962
        Gene:
        MICB (GeneView)
        Functional Consequence:
        intron variant,upstream variant 2KB
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.3758/1882
        HGVS:
        NC_000006.11:g.31464739G, NC_000006.11:g.31464739G>A, NC_000006.12:g.31496962G, NC_000006.12:g.31496962G>A, NG_021405.1:g.3885G, NG_021405.1:g.3885G>A, NM_001289160.1:c.-27+1967A>G, NM_001289160.1:c.-27+1967G>A, NM_001289161.1:c.-1232A>G, NM_001289161.1:c.-1232G>A, NM_005931.4:c.-1232A>G, NM_005931.4:c.-1232G>A, NT_113891.3:g.2974304G, NT_113891.3:g.2974304G>A, NT_167244.1:g.2779446G, NT_167244.1:g.2779446G>A, NT_167244.2:g.2829530G, NT_167244.2:g.2829530G>A, NT_167245.2:g.2744570G, NT_167245.2:g.2744570G>A, NT_167247.2:g.2838918G, NT_167247.2:g.2838918G>A, NT_167248.2:g.2752862A, NT_167248.2:g.2752862A>G, NT_167249.2:g.2796257A, NT_167249.2:g.2796257A>G, XM_005249125.1:c.-27+1967A>G, XM_005249125.1:c.-27+1967G>A, XM_005249126.1:c.-1232A>G, XM_005249126.1:c.-1232G>A, XM_005272818.1:c.-27+1968A>G, XM_005272818.1:c.-27+1968G>A, XM_005272819.1:c.-1230A>G, XM_005272819.1:c.-1230G>A, XM_005274863.1:c.-27+1967A>G, XM_005274863.1:c.-27+1967G>A, XM_005274864.1:c.-1232A>G, XM_005274864.1:c.-1232G>A, XM_005274975.1:c.-27+1983A>G, XM_005274975.1:c.-27+1983G>A, XM_005274976.1:c.-1232A>G, XM_005274976.1:c.-1232G>A, XM_005275250.1:c.-27+1968A>G, XM_005275250.1:c.-27+1968G>A, XM_005275251.1:c.-1230A>G, XM_005275251.1:c.-1230G>A, XM_005275408.1:c.-27+1974A>G, XM_005275408.1:c.-27+1974G>A, XM_005275409.1:c.-1232A>G, XM_005275409.1:c.-1232G>A, XM_005275556.1:c.-27+1973A>G, XM_005275556.1:c.-27+1973G>A, XM_005275557.1:c.-1232A>G, XM_005275557.1:c.-1232G>A, XM_006726002.2:c.-27+62A>G, XM_006726002.2:c.-27+62G>A, XM_006726095.2:c.-27+62A>G, XM_006726095.2:c.-27+62G>A, XM_011514630.1:c.-27+1986A>G, XM_011514630.1:c.-27+1986G>A, XM_011514631.1:c.-27+62A>G, XM_011514631.1:c.-27+62G>A, XM_011546312.1:c.-27+1986A>G, XM_011546312.1:c.-27+1986G>A, XM_011546313.1:c.-27+62A>G, XM_011546313.1:c.-27+62G>A, XM_011547251.1:c.-27+1987A>G, XM_011547251.1:c.-27+1987G>A, XM_011547252.1:c.-27+62A>G, XM_011547252.1:c.-27+62G>A, XM_011547655.1:c.-27+62A>G, XM_011547655.1:c.-27+62G>A, XM_011547656.1:c.-27+1983A>G, XM_011547656.1:c.-27+1983G>A, XM_011548052.1:c.-27+1987A>G, XM_011548052.1:c.-27+1987G>A, XM_011548053.1:c.-27+62A>G, XM_011548053.1:c.-27+62G>A
        10.

        rs3129945 [Homo sapiens]
          agaccaagcctctcaattatactaa[A/G]ttgtccatgatcgacgaggtatttg
          Chromosome:
          6:32374760
          Gene:
          LOC101929163 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.2764/1384
          HGVS:
          NC_000006.11:g.32342537G, NC_000006.11:g.32342537G>A, NC_000006.12:g.32374760G, NC_000006.12:g.32374760G>A, NT_113891.2:g.3812981A, NT_113891.2:g.3812981A>G, NT_113891.3:g.3812875A, NT_113891.3:g.3812875A>G, NT_167244.1:g.3656920G, NT_167244.1:g.3656920G>A, NT_167244.2:g.3707004G, NT_167244.2:g.3707004G>A, NT_167245.1:g.3621453G, NT_167245.1:g.3621453G>A, NT_167245.2:g.3615868G, NT_167245.2:g.3615868G>A, NT_167246.1:g.3685366G, NT_167246.1:g.3685366G>A, NT_167246.2:g.3679746G, NT_167246.2:g.3679746G>A, NT_167247.1:g.3722120G, NT_167247.1:g.3722120G>A, NT_167247.2:g.3716535G, NT_167247.2:g.3716535G>A, NT_167248.1:g.3603403G, NT_167248.1:g.3603403G>A, NT_167248.2:g.3597807G, NT_167248.2:g.3597807G>A, NT_167249.1:g.3690005G, NT_167249.1:g.3690005G>A, NT_167249.2:g.3690707G, NT_167249.2:g.3690707G>A, XM_011515039.1:c.481+8921A>G, XM_011515039.1:c.481+8921G>A, XM_011515040.1:c.482-8208A>G, XM_011515040.1:c.482-8208G>A, XM_011547338.1:c.481+8910A>G, XM_011547338.1:c.481+8910G>A, XM_011547339.1:c.482-8199A>G, XM_011547339.1:c.482-8199G>A, XM_011547954.1:c.481+8905A>G, XM_011547954.1:c.481+8905G>A, XM_011547955.1:c.482-8208A>G, XM_011547955.1:c.482-8208G>A, XM_011548322.1:c.481+8923A>G, XM_011548322.1:c.481+8923G>A, XM_011548323.1:c.482-8208A>G, XM_011548323.1:c.482-8208G>A, XM_011548508.1:c.481+8944A>G, XM_011548508.1:c.481+8944G>A, XM_011548509.1:c.482-8205A>G, XM_011548509.1:c.482-8205G>A
          11.

          rs3129944 [Homo sapiens]
            GGAGAACAAGGAAGAGTAATAACAC[C/G]TTTTATTGAGTGTCTATTGACTACA
            Chromosome:
            6:32373095
            Gene:
            C6orf10 (GeneView) LOC101929163 (GeneView)
            Functional Consequence:
            intron variant,upstream variant 2KB
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.3313/1659
            HGVS:
            NC_000006.11:g.32340872C, NC_000006.11:g.32340872C>G, NC_000006.12:g.32373095C, NC_000006.12:g.32373095C>G, NM_001286474.1:c.-1389C>G, NM_001286474.1:c.-1389G>C, NM_001286475.1:c.-1389C>G, NM_001286475.1:c.-1389G>C, NM_006781.4:c.-1389C>G, NM_006781.4:c.-1389G>C, NT_113891.3:g.3811226G, NT_113891.3:g.3811226G>C, NT_167244.1:g.3655257C, NT_167244.1:g.3655257C>G, NT_167244.2:g.3705341C, NT_167244.2:g.3705341C>G, NT_167245.2:g.3614209C, NT_167245.2:g.3614209C>G, NT_167246.2:g.3678091C, NT_167246.2:g.3678091C>G, NT_167247.1:g.3720457C, NT_167247.1:g.3720457C>G, NT_167247.2:g.3714872C, NT_167247.2:g.3714872C>G, NT_167248.2:g.3596144C, NT_167248.2:g.3596144C>G, NT_167249.2:g.3689044C, NT_167249.2:g.3689044C>G, XM_005248809.1:c.-1389C>G, XM_005248809.1:c.-1389G>C, XM_005248810.1:c.-1389C>G, XM_005248810.1:c.-1389G>C, XM_005272765.1:c.-1389C>G, XM_005272765.1:c.-1389G>C, XM_005272766.1:c.-1389C>G, XM_005272766.1:c.-1389G>C, XM_005274911.1:c.-1389C>G, XM_005274911.1:c.-1389G>C, XM_005274912.1:c.-1389C>G, XM_005274912.1:c.-1389G>C, XM_005274912.2:c.-1389C>G, XM_005274912.2:c.-1389G>C, XM_005275077.1:c.-1389C>G, XM_005275077.1:c.-1389G>C, XM_005275078.1:c.-1389C>G, XM_005275078.1:c.-1389G>C, XM_005275341.1:c.-1389C>G, XM_005275341.1:c.-1389G>C, XM_005275342.1:c.-1389C>G, XM_005275342.1:c.-1389G>C, XM_005275342.2:c.-1389C>G, XM_005275342.2:c.-1389G>C, XM_005275508.1:c.-1389C>G, XM_005275508.1:c.-1389G>C, XM_005275509.1:c.-1389C>G, XM_005275509.1:c.-1389G>C, XM_006725674.2:c.-1389C>G, XM_006725674.2:c.-1389G>C, XM_006725973.2:c.-1389C>G, XM_006725973.2:c.-1389G>C, XM_011514235.1:c.-1389C>G, XM_011514235.1:c.-1389G>C, XM_011514236.1:c.-1389C>G, XM_011514236.1:c.-1389G>C, XM_011514237.1:c.-1389C>G, XM_011514237.1:c.-1389G>C, XM_011514238.1:c.-1389C>G, XM_011514238.1:c.-1389G>C, XM_011514239.1:c.-1389C>G, XM_011514239.1:c.-1389G>C, XM_011514240.1:c.-1389C>G, XM_011514240.1:c.-1389G>C, XM_011514241.1:c.-1389C>G, XM_011514241.1:c.-1389G>C, XM_011514242.1:c.-1389C>G, XM_011514242.1:c.-1389G>C, XM_011514243.1:c.-1389C>G, XM_011514243.1:c.-1389G>C, XM_011514244.1:c.-1389C>G, XM_011514244.1:c.-1389G>C, XM_011514245.1:c.-1389C>G, XM_011514245.1:c.-1389G>C, XM_011514246.1:c.-1389C>G, XM_011514246.1:c.-1389G>C, XM_011515039.1:c.481+7256C>G, XM_011515039.1:c.481+7256G>C, XM_011515040.1:c.481+7256C>G, XM_011515040.1:c.481+7256G>C, XM_011547172.1:c.-1389C>G, XM_011547172.1:c.-1389G>C, XM_011547173.1:c.-1389C>G, XM_011547173.1:c.-1389G>C, XM_011547174.1:c.-1389C>G, XM_011547174.1:c.-1389G>C, XM_011547175.1:c.-1389C>G, XM_011547175.1:c.-1389G>C, XM_011547176.1:c.-1389C>G, XM_011547176.1:c.-1389G>C, XM_011547177.1:c.-1389C>G, XM_011547177.1:c.-1389G>C, XM_011547178.1:c.-1389C>G, XM_011547178.1:c.-1389G>C, XM_011547179.1:c.-1389C>G, XM_011547179.1:c.-1389G>C, XM_011547338.1:c.481+7261C>G, XM_011547338.1:c.481+7261G>C, XM_011547339.1:c.481+7261C>G, XM_011547339.1:c.481+7261G>C, XM_011547587.1:c.-1389C>G, XM_011547587.1:c.-1389G>C, XM_011547588.1:c.-1389C>G, XM_011547588.1:c.-1389G>C, XM_011547589.1:c.-1389C>G, XM_011547589.1:c.-1389G>C, XM_011547590.1:c.-1389C>G, XM_011547590.1:c.-1389G>C, XM_011547591.1:c.-1389C>G, XM_011547591.1:c.-1389G>C, XM_011547592.1:c.-1389C>G, XM_011547592.1:c.-1389G>C, XM_011547593.1:c.-1389C>G, XM_011547593.1:c.-1389G>C, XM_011547594.1:c.-1389C>G, XM_011547594.1:c.-1389G>C, XM_011547826.1:c.-1389C>G, XM_011547826.1:c.-1389G>C, XM_011547827.1:c.-1389C>G, XM_011547827.1:c.-1389G>C, XM_011547828.1:c.-1389C>G, XM_011547828.1:c.-1389G>C, XM_011547829.1:c.-1389C>G, XM_011547829.1:c.-1389G>C, XM_011547830.1:c.-1389C>G, XM_011547830.1:c.-1389G>C, XM_011547831.1:c.-1389C>G, XM_011547831.1:c.-1389G>C, XM_011547832.1:c.-1389C>G, XM_011547832.1:c.-1389G>C, XM_011547833.1:c.-1389C>G, XM_011547833.1:c.-1389G>C, XM_011547834.1:c.-1389C>G, XM_011547834.1:c.-1389G>C, XM_011547954.1:c.481+7250C>G, XM_011547954.1:c.481+7250G>C, XM_011547955.1:c.481+7250C>G, XM_011547955.1:c.481+7250G>C, XM_011548183.1:c.-1389C>G, XM_011548183.1:c.-1389G>C, XM_011548184.1:c.-1389C>G, XM_011548184.1:c.-1389G>C, XM_011548185.1:c.-1389C>G, XM_011548185.1:c.-1389G>C, XM_011548186.1:c.-1389C>G, XM_011548186.1:c.-1389G>C, XM_011548187.1:c.-1389C>G, XM_011548187.1:c.-1389G>C, XM_011548188.1:c.-1389C>G, XM_011548188.1:c.-1389G>C, XM_011548189.1:c.-1389C>G, XM_011548189.1:c.-1389G>C, XM_011548190.1:c.-1389C>G, XM_011548190.1:c.-1389G>C, XM_011548322.1:c.481+7260C>G, XM_011548322.1:c.481+7260G>C, XM_011548323.1:c.481+7260C>G, XM_011548323.1:c.481+7260G>C, XM_011548382.1:c.-1389C>G, XM_011548382.1:c.-1389G>C, XM_011548508.1:c.481+7281C>G, XM_011548508.1:c.481+7281G>C, XM_011548509.1:c.481+7281C>G, XM_011548509.1:c.481+7281G>C
            14.

            rs3117103 [Homo sapiens]
              atgattgaagtataatttacagaca[A/T]gtatttttacaagcacagattataa
              Chromosome:
              6:32381780
              Gene:
              LOC101929163 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.0501/251
              HGVS:
              NC_000006.11:g.32349557A, NC_000006.11:g.32349557A>T, NC_000006.12:g.32381780A, NC_000006.12:g.32381780A>T, NT_113891.2:g.3819992T, NT_113891.2:g.3819992T>A, NT_113891.3:g.3819886T, NT_113891.3:g.3819886T>A, NT_167244.1:g.3663940A, NT_167244.1:g.3663940A>T, NT_167244.2:g.3714024A, NT_167244.2:g.3714024A>T, NT_167245.1:g.3628473A, NT_167245.1:g.3628473A>T, NT_167245.2:g.3622888A, NT_167245.2:g.3622888A>T, NT_167246.1:g.3692386A, NT_167246.1:g.3692386A>T, NT_167246.2:g.3686766A, NT_167246.2:g.3686766A>T, NT_167247.1:g.3729137A, NT_167247.1:g.3729137A>T, NT_167247.2:g.3723552A, NT_167247.2:g.3723552A>T, NT_167248.1:g.3610423A, NT_167248.1:g.3610423A>T, NT_167248.2:g.3604827A, NT_167248.2:g.3604827A>T, NT_167249.1:g.3697022A, NT_167249.1:g.3697022A>T, NT_167249.2:g.3697724A, NT_167249.2:g.3697724A>T, XM_011515039.1:c.481+15941A>T, XM_011515039.1:c.481+15941T>A, XM_011515040.1:c.482-1188A>T, XM_011515040.1:c.482-1188T>A, XM_011547338.1:c.481+15921A>T, XM_011547338.1:c.481+15921T>A, XM_011547339.1:c.482-1188A>T, XM_011547339.1:c.482-1188T>A, XM_011547954.1:c.481+15925A>T, XM_011547954.1:c.481+15925T>A, XM_011547955.1:c.482-1188A>T, XM_011547955.1:c.482-1188T>A, XM_011548322.1:c.481+15943A>T, XM_011548322.1:c.481+15943T>A, XM_011548323.1:c.482-1188A>T, XM_011548323.1:c.482-1188T>A, XM_011548508.1:c.481+15961A>T, XM_011548508.1:c.481+15961T>A, XM_011548509.1:c.482-1188A>T, XM_011548509.1:c.482-1188T>A
              19.

              rs2246626 [Homo sapiens]
                CTGGCGCCAATATTCAGGGGCTGAC[C/T]CTGTGAGGGAACATCTGCCCTGAAG
                Chromosome:
                6:31511349
                Gene:
                MICB (GeneView)
                Functional Consequence:
                downstream variant 500B
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.4832/2420
                HGVS:
                NC_000006.11:g.31479126C, NC_000006.11:g.31479126C>T, NC_000006.12:g.31511349C, NC_000006.12:g.31511349C>T, NG_021405.1:g.18272C, NG_021405.1:g.18272C>T, NM_001289160.1:c.*1215+225C>T, NM_001289160.1:c.*1215+225T>C, NM_001289160.1:c.*1440C>T, NM_001289160.1:c.*1440T>C, NM_001289161.1:c.*1215+225C>T, NM_001289161.1:c.*1215+225T>C, NM_001289161.1:c.*1440C>T, NM_001289161.1:c.*1440T>C, NM_005931.4:c.*1215+225C>T, NM_005931.4:c.*1215+225T>C, NM_005931.4:c.*1440C>T, NM_005931.4:c.*1440T>C, NT_113891.3:g.2988689C, NT_113891.3:g.2988689C>T, NT_167244.1:g.2793815C, NT_167244.1:g.2793815C>T, NT_167244.2:g.2843899C, NT_167244.2:g.2843899C>T, NT_167245.2:g.2759135C, NT_167245.2:g.2759135C>T, NT_167246.1:g.2822045T, NT_167246.1:g.2822045T>C, NT_167246.2:g.2816425T, NT_167246.2:g.2816425T>C, NT_167247.2:g.2853296C, NT_167247.2:g.2853296C>T, NT_167248.2:g.2767227T, NT_167248.2:g.2767227T>C, NT_167249.2:g.2810635T, NT_167249.2:g.2810635T>C, XM_005249126.1:c.*1440C>T, XM_005249126.1:c.*1440T>C, XM_005272818.1:c.*1438C>T, XM_005272818.1:c.*1438T>C, XM_005272819.1:c.*1438C>T, XM_005272819.1:c.*1438T>C, XM_005274864.1:c.*1440C>T, XM_005274864.1:c.*1440T>C, XM_005274976.1:c.*1440C>T, XM_005274976.1:c.*1440T>C, XM_005275250.1:c.*1438C>T, XM_005275250.1:c.*1438T>C, XM_005275251.1:c.*1438C>T, XM_005275251.1:c.*1438T>C, XM_005275409.1:c.*1432C>T, XM_005275409.1:c.*1432T>C, XM_005275557.1:c.*1444C>T, XM_005275557.1:c.*1444T>C

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Write to the Help Desk