Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 26

1.

rs16837730 [Homo sapiens]
    GCATAGCCTTGCTTAACCAAATCCA[C/T]GCTTCAACAAGTACTATCTAAAATG
    Chromosome:
    1:28853502
    Gene:
    OPRD1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.0677/339
    HGVS:
    NC_000001.10:g.29180014C>T, NC_000001.11:g.28853502C>T, NM_000911.3:c.228-5452C>T
    2.

    rs12827056 [Homo sapiens]
      tcccaggaataagcttacttaatca[C/T]gatgaattaactttttgatgtgcag
      Chromosome:
      12:126826075
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1841/922
      HGVS:
      NC_000012.11:g.127310621C>T, NC_000012.12:g.126826075C>T
      3.

      rs11067362 [Homo sapiens]
        ACTCATTTCTTCCGGCCACAATTGT[C/T]TGACCAGAAATGGCATCTAGCCCCA
        Chromosome:
        12:115000277
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.1316/659
        HGVS:
        NC_000012.11:g.115438082T>C, NC_000012.12:g.115000277T>C
        4.

        rs10801805 [Homo sapiens]
          TGGTTTATGTGCATATCCATTACAC[A/G]TTTATTCCTTCAACTAACGTTTGTT
          Chromosome:
          1:90354699
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.4403/2205
          HGVS:
          NC_000001.10:g.90820257G>A, NC_000001.11:g.90354699G>A
          5.

          rs7924284 [Homo sapiens]
            TATCACATGTTCACTACCAAGTTCA[C/T]TGCTTGATCCTCCTACTGGATCCAA
            Chromosome:
            10:100258332
            Gene:
            CWF19L1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.2510/1257
            HGVS:
            NC_000010.10:g.102018089C>T, NC_000010.11:g.100258332C>T, NG_041811.1:g.14350G>A, NM_001303404.1:c.290-1856G>A, NM_001303405.1:c.-122-1856G>A, NM_001303406.1:c.-122-1856G>A, NM_001303407.1:c.-232+1886G>A, NM_018294.5:c.290-1856G>A, XM_005269939.1:c.395-1856G>A, XM_005269940.1:c.323-1856G>A, XM_005269941.1:c.-122-1856G>A, XR_246095.1:n.360-1856G>A, XR_246096.1:n.360-1856G>A
            6.
            7.

            rs4799863 [Homo sapiens]
              GCTCTGGAAAGTGTGTATGTTAAGA[A/G]GGGGTGTTGTAAACTAGGGTCAGAT
              Chromosome:
              18:36293452
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.4878/2443
              HGVS:
              NC_000018.10:g.36293452A>G, NC_000018.9:g.33873415A>G, NG_042837.1:g.757A>G
              8.

              rs4767364 [Homo sapiens]
                GCACCTGCTTCTAACACTGGGGTAC[A/G]TATACTCCACAGGTATAAAATGAAA
                Chromosome:
                12:112083644
                Gene:
                NAA25 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.3734/1870
                HGVS:
                NC_000012.11:g.112521448G>A, NC_000012.12:g.112083644G>A, NG_017071.1:g.30188C>T, NM_024953.3:c.403-2510C>T, XM_005253938.1:c.-6-2510C>T, XM_006719606.1:c.319-2510C>T, XR_243023.1:n.652-2510C>T, XR_243023.2:n.652-2510C>T, XR_944730.1:n.652-2510C>T, XR_944731.1:n.652-2510C>T
                9.

                rs4648328 [Homo sapiens]
                  AGCTCCACGCTGGTCTCTATCCCAG[C/T]ACCTGGATATGGTAGAGAGCAGAAG
                  Chromosome:
                  12:111784984
                  Gene:
                  ALDH2 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.2003/1003
                  HGVS:
                  NC_000012.11:g.112222788C>T, NC_000012.12:g.111784984C>T, NG_012250.1:g.23443C>T, NM_000690.3:c.361-283C>T, NM_001204889.1:c.220-283C>T
                  10.

                  rs3810481 [Homo sapiens]
                    CCTACCTGGTGGGCCCTGAATGACC[A/G]TGAAAGGCTTCTCCAGAGCCTCCCT
                    Chromosome:
                    20:63562092
                    Gene:
                    HELZ2 (GeneView)
                    Functional Consequence:
                    missense
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.2073/1038
                    HGVS:
                    NC_000020.10:g.62193445G>A, NC_000020.11:g.63562092G>A, NM_001037335.2:c.6509C>T, NM_033405.3:c.4802C>T, NP_001032412.2:p.Thr2170Met, NP_208384.3:p.Thr1601Met, XM_011529092.1:c.6509C>T, XP_011527394.1:p.Thr2170Met
                    13.

                    rs2287802 [Homo sapiens]
                      GCACACTTTTGTCTCCATTGGCCTC[C/T]GGTGCTCTTTGGGGAGCCTCCTCTG
                      Chromosome:
                      19:10002012
                      Gene:
                      COL5A3 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.3836/1921
                      HGVS:
                      NC_000019.10:g.10002012A>G, NC_000019.9:g.10112688A>G, NM_015719.3:c.850-131T>C, XM_011528042.1:c.847-131T>C
                      14.
                      15.

                      rs1789924 [Homo sapiens]
                        ATTTTGAATCCACATGGTGCAGTTA[C/T]GAAGGAGGAGTAGGGAAATTGGATA
                        Chromosome:
                        4:99353129
                        Gene:
                        ADH1C (GeneView)
                        Functional Consequence:
                        upstream variant 2KB
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        T=0.2163/1083
                        HGVS:
                        NC_000004.11:g.100274286C>T, NC_000004.12:g.99353129C>T, NG_011718.1:g.4632G>A, NM_000669.4:c.-454G>A, NR_133005.1:n.-84G>A, XM_011531588.1:c.-454G>A, XM_011531589.1:c.-694G>A
                        16.

                        rs1573496 [Homo sapiens]
                          TATACCTGGTTTCACTGTAGTCACT[C/G]CTTCTCCAATGCTCTCTACAATCCC
                          Chromosome:
                          4:99428512
                          Gene:
                          ADH7 (GeneView)
                          Functional Consequence:
                          missense
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.0380/190
                          HGVS:
                          NC_000004.11:g.100349669C>G, NC_000004.12:g.99428512C>G, NM_000673.4:c.275G>C, NM_001166504.1:c.299G>C, NP_000664.2:p.Gly92Ala, NP_001159976.1:p.Gly100Ala
                          18.

                          rs1431918 [Homo sapiens]
                            GCATCTCTACTTTTTTTTCTTTTGA[C/T]ATTTAAGTTTCCTTGTACCAGTATT
                            Chromosome:
                            8:61973294
                            Gene:
                            LOC101929628 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.3161/1583
                            HGVS:
                            NC_000008.10:g.62885853G>A, NC_000008.11:g.61973294G>A, XR_428354.2:n.1060+794G>A, XR_928961.1:n.1060+794G>A, XR_928962.1:n.1060+794G>A
                            20.

                            rs1041973 [Homo sapiens]
                              CAACTTCTGAAGTTTCTACCAGCTG[A/C]AGTTGCTGATTCTGGTATTTATACC
                              Chromosome:
                              2:102339008
                              Gene:
                              IL1RL1 (GeneView)
                              Functional Consequence:
                              missense,nc transcript variant,utr variant 5 prime
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.2819/1412
                              HGVS:
                              NC_000002.11:g.102955468C>A, NC_000002.12:g.102339008C>A, NM_001282408.1:c.-119C>A, NM_003856.3:c.233C>A, NM_016232.4:c.233C>A, NP_003847.2:p.Ala78Glu, NP_057316.3:p.Ala78Glu, NR_104167.1:n.470C>A, XM_006712839.2:c.233C>A, XM_011512151.1:c.233C>A, XP_006712902.1:p.Ala78Glu, XP_011510453.1:p.Ala78Glu

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Write to the Help Desk