Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 41

2.

rs17006053 [Homo sapiens]
    ATAACACCCTGGCCCTAGCACTGCT[A/C]AACTTTCACCTGACATATATGGTAT
    Chromosome:
    4:122708506
    Gene:
    BBS12 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2770/1387
    HGVS:
    NC_000004.11:g.123629661C>A, NC_000004.12:g.122708506C>A, XM_011531680.1:c.-11+7940C>A
    4.

    rs13147359 [Homo sapiens]
      GAGGAAATTGATGCATATTGAGTTA[C/T]ATAAGAAAGGAAGAATTGACGGGTC
      Chromosome:
      4:122676016
      Gene:
      IL21-AS1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.0096/48
      HGVS:
      NC_000004.11:g.123597171T>C, NC_000004.12:g.122676016T>C, NR_104126.1:n.3129-12521T>C, XR_244708.1:n.3126-12521T>C
      5.

      rs13143866 [Homo sapiens]
        ACAAGGTGCATGAGATGCTAGAAAT[A/G]TATGTTTTGATAATTAGGCACATTG
        Chromosome:
        4:122619603
        Gene:
        IL21-AS1 (GeneView) IL21 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.1897/950
        HGVS:
        NC_000004.11:g.123540758G>A, NC_000004.12:g.122619603G>A, NG_031966.1:g.6455C>T, NM_001207006.2:c.204+1098C>T, NM_021803.3:c.204+1098C>T, NR_104126.1:n.510+111G>A, XR_244708.1:n.507+111G>A
        6.

        rs13140464 [Homo sapiens]
          GAAGTTGGAGTTCGCACAAACTACT[G/T]CTCCTGCTTAAACAGATGGTAGGAA
          Chromosome:
          4:122578590
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.0551/276
          HGVS:
          NC_000004.11:g.123499745G>T, NC_000004.12:g.122578590G>T
          7.

          rs13137822 [Homo sapiens]
            TTTTAGCAGGGACTTCCGAGCACAT[C/G]TGGTGCTTTTGTGGAAATGCAAAAA
            Chromosome:
            4:122636081
            Gene:
            IL21-AS1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.4710/2359
            HGVS:
            NC_000004.11:g.123557236C>G, NC_000004.12:g.122636081C>G, NR_104126.1:n.2797+7085C>G, XR_244708.1:n.2794+7085C>G
            10.

            rs11930631 [Homo sapiens]
              ttctgacactatttatggaacttgg[A/G]gctagtgacttaactcctttgtaga
              Chromosome:
              4:122614140
              Gene:
              IL21 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.1168/585
              HGVS:
              NC_000004.11:g.123535295G>A, NC_000004.12:g.122614140G>A, NG_031966.1:g.11918C>T, NM_001207006.2:c.361-1212C>T, NM_021803.3:c.361-1212C>T
              12.

              rs10857092 [Homo sapiens]
                AAATCAACTCTGATTGCCTAGTTTC[A/G]AATTCTTTTATGTGAGAGAAACAAG
                Chromosome:
                4:122468064
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.1577/790
                HGVS:
                NC_000004.11:g.123389219G>A, NC_000004.12:g.122468064G>A
                13.

                rs10518400 [Homo sapiens]
                  TGTCATTGCTTTATTCTCTTTTTGC[A/G]CTGCATACTTCCTAAGAGACTGTAA
                  Chromosome:
                  4:122661271
                  Gene:
                  IL21-AS1 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.0821/411
                  HGVS:
                  NC_000004.11:g.123582426G>A, NC_000004.12:g.122661271G>A, NR_104126.1:n.3128+11560G>A, XR_244708.1:n.3125+11560G>A
                  14.

                  rs9307509 [Homo sapiens]
                    TTAAAATTAGTTCATACAAAAAAAA[A/C/T]CACATATTGTGCTACAAAATTAATA
                    Chromosome:
                    4:122667336
                    Gene:
                    IL21-AS1 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.0537/269
                    HGVS:
                    NC_000004.11:g.123588491T>A, NC_000004.12:g.122667336T>A, NR_104126.1:n.3128+17625T>A, XR_244708.1:n.3125+17625T>A
                    15.

                    rs7694252 [Homo sapiens]
                      TGGGAACTCTGGTCCTACTTGCCAC[A/G]GGCATATCCCCAGCAGAGATGAGGA
                      Chromosome:
                      4:122640281
                      Gene:
                      IL21-AS1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.2047/1025
                      HGVS:
                      NC_000004.11:g.123561436G>A, NC_000004.12:g.122640281G>A, NR_104126.1:n.2798-7820G>A, XR_244708.1:n.2795-7820G>A
                      16.

                      rs7685609 [Homo sapiens]
                        ACATTAGCAGATAGAACATGTCTGC[A/G]AATGTACTCAGTGAAAGTGGCTTCT
                        Chromosome:
                        4:122644147
                        Gene:
                        IL21-AS1 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.0737/369
                        HGVS:
                        NC_000004.11:g.123565302G>A, NC_000004.12:g.122644147G>A, NR_104126.1:n.2798-3954G>A, XR_244708.1:n.2795-3954G>A
                        17.

                        rs6840978 [Homo sapiens]
                          CCAATATGCATTTGAGATGATTTTT[C/T]AGTTACATGGAGTTTTCCTTCCATA
                          Chromosome:
                          4:122633552
                          Gene:
                          IL21-AS1 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.1406/704
                          HGVS:
                          NC_000004.11:g.123554707C>T, NC_000004.12:g.122633552C>T, NR_104126.1:n.2797+4556C>T, XR_244708.1:n.2794+4556C>T
                          18.

                          rs6837455 [Homo sapiens]
                            GCTGGAGACCCAGAGAACAGTCAGT[C/G]CTGCAGTTCAAGTCAGAAGGCCGAC
                            Chromosome:
                            4:122667787
                            Gene:
                            IL21-AS1 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.2508/1256
                            HGVS:
                            NC_000004.11:g.123588942G>C, NC_000004.12:g.122667787G>C, NR_104126.1:n.3128+18076G>C, XR_244708.1:n.3125+18076G>C
                            19.

                            rs6835457 [Homo sapiens]
                              cacctcccaacacagacacattgtc[A/G]tctaagactccaggcaagctccttt
                              Chromosome:
                              4:122589971
                              Validated:
                              no info
                              Global MAF:
                              G=0.3704/1855
                              HGVS:
                              NC_000004.11:g.123511126A>G, NC_000004.12:g.122589971A>G

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Write to the Help Desk