Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 33

1.

rs13022873 [Homo sapiens]
    TTTATTTTTTATTGAGTTAAAGTAT[A/C]CCCATATAATTTACCATGTTTACCT
    Chromosome:
    2:27592643
    Gene:
    ZNF512 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.3075/1540
    HGVS:
    NC_000002.11:g.27815510A>C, NC_000002.12:g.27592643A>C, NM_001271286.1:c.90-5427A>C, NM_001271287.1:c.-142-5424A>C, NM_001271288.1:c.-139-5427A>C, NM_001271289.1:c.-142-5424A>C, NM_001271318.1:c.-142-5424A>C, NM_032434.3:c.90-5424A>C, XM_005264601.1:c.90-5427A>C, XM_005264602.1:c.90-5424A>C, XM_005264603.1:c.-136-5430A>C
    2.

    rs12286037 [Homo sapiens]
      actatagtacaatgtctttaccaaa[C/T]tggaagaccatagtgcagtcttcga
      Chromosome:
      11:116781491
      Gene:
      ZPR1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.0986/494
      HGVS:
      NC_000011.10:g.116781491C>T, NC_000011.9:g.116652207C>T, NM_001317086.1:c.1017+667G>A, NM_003904.4:c.1179+667G>A
      3.

      rs11825181 [Homo sapiens]
        gctcacctttaagaaaccagcactt[A/G]ttgagtttttgtgtaacattaagaa
        Chromosome:
        11:116755542
        Gene:
        BUD13 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.0921/461
        HGVS:
        NC_000011.10:g.116755542G>A, NC_000011.9:g.116626258G>A, NM_001159736.1:c.1364+1604C>T, NM_032725.3:c.1766+1604C>T, XM_011543035.1:c.1667+1604C>T
        4.

        rs11823543 [Homo sapiens]
          AACAGCATGATATCAAACAAGGATA[A/G]GGTCAATACAGAGGCCAGTGCTGTT
          Chromosome:
          11:116778419
          Gene:
          ZPR1 (GeneView)
          Functional Consequence:
          utr variant 3 prime
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.0976/489
          HGVS:
          NC_000011.10:g.116778419G>A, NC_000011.9:g.116649135G>A, NM_001317086.1:c.*506C>T, NM_003904.4:c.*506C>T
          5.

          rs11820589 [Homo sapiens]
            ACGGGCCCTCCTAGGAGATGGATCC[A/G]GGGTGTCATGACGGTCCTTCCTAGG
            Chromosome:
            11:116763146
            Gene:
            BUD13 (GeneView)
            Functional Consequence:
            missense
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.0889/445
            HGVS:
            NC_000011.10:g.116763146G>A, NC_000011.9:g.116633862G>A, NM_001159736.1:c.443C>T, NM_032725.3:c.443C>T, NP_001153208.1:p.Pro148Leu, NP_116114.1:p.Pro148Leu, XM_011543035.1:c.344C>T, XP_011541337.1:p.Pro115Leu
            6.

            rs10830956 [Homo sapiens]
              TGAATTAATTCATCTTTAGTGGAGG[C/T]AGCAATTAGTATATCATCCATATAA
              Chromosome:
              11:92947847
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.3594/1800
              HGVS:
              NC_000011.10:g.92947847C>T, NC_000011.9:g.92681013C>T
              7.

              rs10790162 [Homo sapiens]
                AGTAGACTCCAAAACCCTATGTACA[A/G/T]TATGATCCCAATTATGTTCAAAAAA
                Chromosome:
                11:116768388
                Gene:
                BUD13 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.1224/613
                HGVS:
                NC_000011.10:g.116768388A>G, NC_000011.9:g.116639104A>G, NM_001159736.1:c.237+1741T>C, NM_032725.3:c.237+1741T>C, XM_011543035.1:c.138+1741T>C
                8.

                rs10468017 [Homo sapiens]
                  GGCACAGTGACGGGCAGACTTGCAA[C/T]ATTTCATGGGTGGATGCACTGAAAG
                  Chromosome:
                  15:58386313
                  Gene:
                  LOC102724766 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.1927/965
                  HGVS:
                  NC_000015.10:g.58386313C>T, NC_000015.9:g.58678512C>T, XR_429537.2:n.164+33658G>A, XR_932289.1:n.165-1457G>A
                  9.

                  rs9987289 [Homo sapiens]
                    AGCTGACTTTGCTAGATGCTTGGGC[A/G]TCAATATCACGTGGAACCAGCCTTT
                    Chromosome:
                    8:9325848
                    Gene:
                    LOC157273 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.1140/571
                    HGVS:
                    NC_000008.10:g.9183358A>G, NC_000008.11:g.9325848A>G, NR_040039.1:n.364-54A>G
                    10.

                    rs9939224 [Homo sapiens]
                      gctattgttttcaccgattgttgtt[G/T]ttgttctattatttcattcataggc
                      Chromosome:
                      16:56968820
                      Gene:
                      CETP (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.2472/1238
                      HGVS:
                      NC_000016.10:g.56968820T>G, NC_000016.9:g.57002732T>G, NG_008952.1:g.11898T>G, NM_000078.2:c.234-566T>G, NM_001286085.1:c.234-566T>G, XM_005255776.1:c.234-566T>G, XM_006721124.2:c.234-566T>G
                      11.

                      rs3764261 [Homo sapiens]
                        CCTTCACCTGTCGGTAGGCATCTGG[G/T]TTGTCTGCtatctcattcactcttc
                        Chromosome:
                        16:56959412
                        Allele Origin:
                        G(germline)/T(germline,unknown)
                        Clinical significance:
                        untested
                        Validated:
                        no info
                        Global MAF:
                        A=0.2895/1450
                        HGVS:
                        NC_000016.10:g.56959412C>A, NC_000016.9:g.56993324C>A, NG_008952.1:g.2490C>A
                        12.

                        rs3749147 [Homo sapiens]
                          AGCTGCGGACGCCGCCATCTTCCTC[C/T]TGGCCCCACCCACCCGACCATAGAG
                          Chromosome:
                          2:27629051
                          Gene:
                          CCDC121 (GeneView) GPN1 (GeneView)
                          Functional Consequence:
                          intron variant,missense,nc transcript variant,upstream variant 2KB
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.1835/919
                          HGVS:
                          NC_000002.11:g.27851918G>A, NC_000002.12:g.27629051G>A, NM_001142683.2:c.-288C>T, NM_001145047.1:c.8-324G>A, NM_001145048.1:c.-127+337G>A, NM_001145049.1:c.-68+337G>A, NM_007266.3:c.35G>A, NM_024584.4:c.-220C>T, NP_009197.2:p.Arg12Lys, NR_026735.1:n.56G>A, XM_005264560.1:c.-288C>T, XM_005264560.2:c.-288C>T
                          13.

                          rs2954033 [Homo sapiens]
                            agccctggttgcatatttgaatcat[A/G]taggtaaaaaatgtgaatgtccagg
                            Chromosome:
                            8:125481504
                            Gene:
                            LOC105375745 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.2091/1047
                            HGVS:
                            NC_000008.10:g.126493746A>G, NC_000008.11:g.125481504A>G, XR_928628.1:n.256+8190A>G
                            14.

                            rs2954026 [Homo sapiens]
                              ACATAACAGTCTAAGGTAGTTCTAA[G/T]TTGGAGGTGGGGCAGAGCCTTACTG
                              Chromosome:
                              8:125472284
                              Gene:
                              LOC105375745 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              T=0.2087/1045
                              HGVS:
                              NC_000008.10:g.126484526T>G, NC_000008.11:g.125472284T>G, XR_928628.1:n.78-852T>G
                              15.

                              rs2266788 [Homo sapiens]
                                ACCAAAGGGGCTGCTGTCTCCTGCA[C/T]ATCCAGCCTCCTGCGACTCCCCAAT
                                Chromosome:
                                11:116789970
                                Gene:
                                APOA5 (GeneView) ZPR1 (GeneView)
                                Functional Consequence:
                                upstream variant 2KB,utr variant 3 prime
                                Allele Origin:
                                T(germline)/C(germline)
                                Clinical significance:
                                other
                                Validated:
                                no info
                                Global MAF:
                                G=0.1258/630
                                HGVS:
                                NC_000011.10:g.116789970G>A, NC_000011.9:g.116660686G>A, NG_015894.1:g.7451C>T, NM_001166598.1:c.*158C>T, NM_001317086.1:c.-1980C>T, NM_003904.4:c.-1980C>T, NM_052968.4:c.*158C>T
                                16.

                                rs2206277 [Homo sapiens]
                                  AAACATCTCTCATAATTGGGGAGAT[A/G]GTGAGCAAAGAGACTAGGGTGCAGG
                                  Chromosome:
                                  6:50830813
                                  Gene:
                                  TFAP2B (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  T=0.2117/1060
                                  HGVS:
                                  NC_000006.11:g.50798526C>T, NC_000006.12:g.50830813C>T, NG_008438.1:g.17088C>T, NM_003221.3:c.601+2134C>T, XM_005249347.1:c.628+2134C>T, XM_005249348.1:c.649+497C>T, XM_006715176.2:c.601+2134C>T, XM_006715177.2:c.547+2134C>T, XM_011514834.1:c.628+2134C>T, XM_011514835.1:c.628+2134C>T, XM_011514836.1:c.628+2134C>T, XM_011514837.1:c.628+2134C>T
                                  17.

                                  rs2197089 [Homo sapiens]
                                    acgggacaatggtgggcatgtctta[C/T]gaaaaggtgctttcacccccatccc
                                    Chromosome:
                                    8:19968862
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    G=0.4579/2293
                                    HGVS:
                                    NC_000008.10:g.19826373G>A, NC_000008.11:g.19968862G>A, NG_008855.1:g.34792G>A
                                    18.

                                    rs2075290 [Homo sapiens]
                                      TGAAATAATTCATCAAGGAGATAAA[C/T]ATTTGGGCTAAGTCAACCCATACAT
                                      Chromosome:
                                      11:116782580
                                      Gene:
                                      ZPR1 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                      Global MAF:
                                      C=0.1412/707
                                      HGVS:
                                      NC_000011.10:g.116782580C>T, NC_000011.9:g.116653296C>T, NM_001317086.1:c.931-336G>A, NM_003904.4:c.1093-336G>A
                                      19.

                                      rs2043085 [Homo sapiens]
                                        CAGTGTCCAGAAATTGAACATTGTG[A/G]GGTATATTTAGAGTATCTGGCTGGT
                                        Chromosome:
                                        15:58388755
                                        Gene:
                                        LOC102724766 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                        Global MAF:
                                        C=0.4940/2474
                                        HGVS:
                                        NC_000015.10:g.58388755T>C, NC_000015.9:g.58680954T>C, XR_429537.2:n.164+31216A>G, XR_932289.1:n.165-3899A>G
                                        20.

                                        rs1919128 [Homo sapiens]
                                          GGATATAAAAAACCCTGGGACAGAT[A/G]TTTTGCAGCCTGAAGAGACCTATAT
                                          Chromosome:
                                          2:27578892
                                          Gene:
                                          C2orf16 (GeneView)
                                          Functional Consequence:
                                          missense
                                          Validated:
                                          by 1000G,by cluster,by frequency,by hapmap,by submitter
                                          Global MAF:
                                          G=0.2684/1344
                                          HGVS:
                                          NC_000002.11:g.27801759A>G, NC_000002.12:g.27578892A>G, NM_032266.3:c.2320A>G, NP_115642.3:p.Ile774Val

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Write to the Help Desk