Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 43

1.

rs12370156 [Homo sapiens]
    GTGGTGTCTGCTCAATAGTCTGACA[C/T]CAAATATCAAATGCATCCACACAGA
    Chromosome:
    12:47860350
    Gene:
    VDR (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    T=0.4537/2272
    HGVS:
    NC_000012.11:g.48254133C>T, NC_000012.12:g.47860350C>T, NG_008731.1:g.49682G>A, NM_000376.2:c.278-2662G>A, NM_001017535.1:c.278-2662G>A, NM_001017536.1:c.428-2662G>A, XM_006719587.2:c.278-2662G>A, XM_011538720.1:c.278-2662G>A
    2.

    rs11574139 [Homo sapiens]
      GGAAGCATGTAGGAGAATCCAAGCG[A/T]GGTCAACAGAGAAGGCAGGAATGTG
      Chromosome:
      12:47841772
      Gene:
      VDR (GeneView)
      Functional Consequence:
      utr variant 3 prime
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.0304/152
      HGVS:
      NC_000012.11:g.48235555T>A, NC_000012.12:g.47841772T>A, NG_008731.1:g.68260A>T, NM_000376.2:c.*2974A>T, NM_001017535.1:c.*2974A>T, NM_001017536.1:c.*2974A>T
      3.

      rs11568820 [Homo sapiens]
        ATATTCCTGAGTAAACTAGGTCACA[A/G]TAAAAACTTATTTCTTATTATGGGT
        Chromosome:
        12:47908762
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.4569/2288
        HGVS:
        NC_000012.11:g.48302545C>T, NC_000012.12:g.47908762C>T, NG_008731.1:g.1270G>A
        4.

        rs11168314 [Homo sapiens]
          CATGTAACTCAGCTTTGTTGAAATG[A/G]TATGTACTCAGACATTCATCCCACA
          Chromosome:
          12:47936846
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.2732/1368
          HGVS:
          NC_000012.11:g.48330629G>A, NC_000012.12:g.47936846G>A
          5.

          rs11168287 [Homo sapiens]
            AGTTGTTCTAATCTCTCTCCTAACA[A/G]TCAGAGAAGCTGAGCTACAAATCTG
            Chromosome:
            12:47891631
            Gene:
            VDR (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.4728/2368
            HGVS:
            NC_000012.11:g.48285414G>A, NC_000012.12:g.47891631G>A, NG_008731.1:g.18401C>T, NM_000376.2:c.-83-8857C>T, NM_001017535.1:c.-84+8206C>T, NM_001017536.1:c.68-8857C>T, XM_006719587.2:c.-2-12516C>T, XM_011538720.1:c.-3+8206C>T
            6.

            rs11168284 [Homo sapiens]
              AGCCTGGCCGAGTCCAGTACCCCCA[A/G]TCGCCTGCCTGAGCAGCTTCAGGGC
              Chromosome:
              12:47889266
              Gene:
              VDR (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency
              Global MAF:
              G=0.4519/2263
              HGVS:
              NC_000012.11:g.48283049A>G, NC_000012.12:g.47889266A>G, NG_008731.1:g.20766T>C, NM_000376.2:c.-83-6492T>C, NM_001017535.1:c.-83-6492T>C, NM_001017536.1:c.68-6492T>C, XM_006719587.2:c.-2-10151T>C, XM_011538720.1:c.-2-10151T>C
              7.

              rs11168275 [Homo sapiens]
                TGTCGGGTCATCACGATCTGTACCC[A/G]TATCTTCACCCAAGGACTGTTTGTC
                Chromosome:
                12:47878492
                Gene:
                VDR (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.3912/1959
                HGVS:
                NC_000012.11:g.48272275T>C, NC_000012.12:g.47878492T>C, NG_008731.1:g.31540A>G, NM_000376.2:c.146+476A>G, NM_001017535.1:c.146+476A>G, NM_001017536.1:c.296+476A>G, XM_006719587.2:c.146+476A>G, XM_011538720.1:c.146+476A>G
                8.

                rs10875712 [Homo sapiens]
                  TAACGGAGGAACCCAGAAGCTGAGG[C/G]TTAAGTTTTGGTGTTGTCCTGGATC
                  Chromosome:
                  12:47969470
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.2045/1024
                  HGVS:
                  NC_000012.11:g.48363253C>G, NC_000012.12:g.47969470C>G
                  9.

                  rs10875694 [Homo sapiens]
                    ATGACACAGTAGTTGTAGGAAGGAG[A/T]TTACCCCTGAAGCTTGTTCTTCATT
                    Chromosome:
                    12:47887877
                    Gene:
                    VDR (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.1442/722
                    HGVS:
                    NC_000012.11:g.48281660T>A, NC_000012.12:g.47887877T>A, NG_008731.1:g.22155A>T, NM_000376.2:c.-83-5103A>T, NM_001017535.1:c.-83-5103A>T, NM_001017536.1:c.68-5103A>T, XM_006719587.2:c.-2-8762A>T, XM_011538720.1:c.-2-8762A>T
                    10.

                    rs10459217 [Homo sapiens]
                      ATACTGCTGACCCTGGTTTGGCAAA[C/T]GGTGTTCCACAGCATACTAGCTCTA
                      Chromosome:
                      12:47922478
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.2718/1361
                      HGVS:
                      NC_000012.11:g.48316261T>C, NC_000012.12:g.47922478T>C
                      11.

                      rs7975232 [Homo sapiens]
                        AAGGCACAGGAGCTCTCAGCTGGGC[A/C]CCTCACTGCTCAATCCCACCACCCC
                        Chromosome:
                        12:47845054
                        Gene:
                        LOC105369749 (GeneView) VDR (GeneView)
                        Functional Consequence:
                        intron variant,upstream variant 2KB
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.4846/2427
                        HGVS:
                        NC_000012.11:g.48238837C>A, NC_000012.12:g.47845054C>A, NG_008731.1:g.64978G>T, NM_000376.2:c.1025-49G>T, NM_001017535.1:c.1025-49G>T, NM_001017536.1:c.1175-49G>T, XM_006719587.2:c.1025-49G>T, XM_011538720.1:c.1025-49G>T, XR_944903.1:n.-1761C>A
                        12.

                        rs7974708 [Homo sapiens]
                          AGATAACCCCACTCATTCTCTTTCA[C/T]CCACATCCTCAAGCAAATGACAGAC
                          Chromosome:
                          12:47876382
                          Gene:
                          VDR (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency
                          Global MAF:
                          C=0.1755/879
                          HGVS:
                          NC_000012.11:g.48270165T>C, NC_000012.12:g.47876382T>C, NG_008731.1:g.33650A>G, NM_000376.2:c.146+2586A>G, NM_001017535.1:c.146+2586A>G, NM_001017536.1:c.296+2586A>G, XM_006719587.2:c.146+2586A>G, XM_011538720.1:c.146+2586A>G
                          13.

                          rs7965281 [Homo sapiens]
                            TGACACCTTCTCTCAGTTCTGGTAG[A/G]TATCATGGAGCAGGAGTCCCTAGCA
                            Chromosome:
                            12:47837827
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.3882/1944
                            HGVS:
                            NC_000012.11:g.48231610A>G, NC_000012.12:g.47837827A>G
                            14.

                            rs7305032 [Homo sapiens]
                              TGCTGTTCCTATGGATCTCAATCAA[A/G]AAAGAATTTGGGACCCATCAAGTCA
                              Chromosome:
                              12:47856077
                              Gene:
                              VDR (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.4277/2142
                              HGVS:
                              NC_000012.11:g.48249860G>A, NC_000012.12:g.47856077G>A, NG_008731.1:g.53955C>T, NM_000376.2:c.584-276C>T, NM_001017535.1:c.584-276C>T, NM_001017536.1:c.734-276C>T, XM_006719587.2:c.584-276C>T, XM_011538720.1:c.584-276C>T
                              15.

                              rs7299460 [Homo sapiens]
                                CTGGTGGGTTCTGCTTCCTGCTATC[C/T]CTCAGAGGGCCTGGAGTCATGCTGG
                                Chromosome:
                                12:47902485
                                Gene:
                                VDR (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                C=0.4736/2372
                                HGVS:
                                NC_000012.11:g.48296268C>T, NC_000012.12:g.47902485C>T, NG_008731.1:g.7547G>A, NM_000376.2:c.-84+2470G>A, NM_001017535.1:c.-206+2470G>A, NM_001017536.1:c.67+2079G>A, XM_006719587.2:c.-3+2470G>A, XM_011538720.1:c.-125+2470G>A
                                16.

                                rs7139166 [Homo sapiens]
                                  GGAAGGATCCCCTTGCCCAAAGCAT[C/G]GTGGGAAAGCTAGCGGTGATTCTTG
                                  Chromosome:
                                  12:47906551
                                  Gene:
                                  VDR (GeneView)
                                  Functional Consequence:
                                  upstream variant 2KB
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  G=0.1765/884
                                  HGVS:
                                  NC_000012.11:g.48300334C>G, NC_000012.12:g.47906551C>G, NG_008731.1:g.3481G>C, NM_000376.2:c.-1680G>C, NM_001017535.1:c.-1802G>C, NM_001017536.1:c.-1921G>C, XM_006719587.2:c.-1599G>C, XM_011538720.1:c.-1721G>C
                                  17.

                                  rs4760674 [Homo sapiens]
                                    CTTACAATTTTTGCAAAGGCAGTTT[A/C]TCCGAATGCTCCGCATGTGTGTACC
                                    Chromosome:
                                    12:47963231
                                    Gene:
                                    TMEM106C (GeneView)
                                    Functional Consequence:
                                    upstream variant 2KB
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    A=0.2266/1135
                                    HGVS:
                                    NC_000012.11:g.48357014A>C, NC_000012.12:g.47963231A>C, NM_001143841.1:c.-431A>C, NM_001143842.1:c.-502A>C, NM_001143843.1:c.-502A>C, NM_024056.3:c.-431A>C
                                    18.

                                    rs4760648 [Homo sapiens]
                                      AGCTCTGTATCATGCACAGATGGAA[A/C/T]AGCACCCCATAGCTTTCAATGGCTC
                                      Chromosome:
                                      12:47886882
                                      Gene:
                                      VDR (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      C=0.4918/2463
                                      HGVS:
                                      NC_000012.11:g.48280665C>T, NC_000012.12:g.47886882C>T, NG_008731.1:g.23150G>A, NM_000376.2:c.-83-4108G>A, NM_001017535.1:c.-83-4108G>A, NM_001017536.1:c.68-4108G>A, XM_006719587.2:c.-2-7767G>A, XM_011538720.1:c.-2-7767G>A
                                      19.

                                      rs4516035 [Homo sapiens]
                                        GATGACCTCCTTTAGCCAGGGAAGA[C/T]ATTGCTATTCGCCTCTTACAGAGGA
                                        Chromosome:
                                        12:47906043
                                        Gene:
                                        VDR (GeneView)
                                        Functional Consequence:
                                        upstream variant 2KB
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        C=0.1771/887
                                        HGVS:
                                        NC_000012.11:g.48299826T>C, NC_000012.12:g.47906043T>C, NG_008731.1:g.3989A>G, NM_000376.2:c.-1172A>G, NM_001017535.1:c.-1294A>G, NM_001017536.1:c.-1413A>G, XM_006719587.2:c.-1091A>G, XM_011538720.1:c.-1213A>G
                                        20.

                                        rs4237856 [Homo sapiens]
                                          ATCCATTTGCAAGATGTCAAAGGGC[A/C]GCTGAGCCTGGGCTGCTTCCCAGGG
                                          Chromosome:
                                          12:47944267
                                          Validated:
                                          by 1000G,by cluster,by frequency,by hapmap
                                          Global MAF:
                                          C=0.1787/895
                                          HGVS:
                                          NC_000012.11:g.48338050C>A, NC_000012.12:g.47944267C>A

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Write to the Help Desk