Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 7

1.

rs6968865 [Homo sapiens]
    gattgcttgcttgttggttgggaga[A/T]atctccacacattgggtaaaagaag
    Chromosome:
    7:17247645
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.4567/2287
    HGVS:
    NC_000007.13:g.17287269A>T, NC_000007.14:g.17247645A>T
    2.

    rs6495122 [Homo sapiens]
      GGCAGAGATGGTTGCCTGTCCCACC[A/C]CCTTTCACCCTCAGGGGCTCTGGTT
      Chromosome:
      15:74833304
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.2949/1477
      HGVS:
      NC_000015.10:g.74833304A>C, NC_000015.9:g.75125645A>C
      3.

      rs2472297 [Homo sapiens]
        ACACTCTGTTTCCAAGTTAGTAATG[C/T]CTCTTTACATATAAACACTGATGTT
        Chromosome:
        15:74735539
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.0657/329
        HGVS:
        NC_000015.10:g.74735539C>T, NC_000015.9:g.75027880C>T, NG_008431.1:g.17998C>T
        4.

        rs2470893 [Homo sapiens]
          GTTCCCTTCTCTGTCAATCGCCAGC[A/G]CCTCCGAACAGCTCCTGGCACATAG
          Chromosome:
          15:74727108
          Gene:
          CYP1A1 (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.0905/453
          HGVS:
          NC_000015.10:g.74727108C>T, NC_000015.9:g.75019449C>T, NG_008431.1:g.9567C>T, NM_000499.3:c.-1694G>A, NM_000499.4:c.-1694G>A, NM_001319216.1:c.-1697G>A, NM_001319217.1:c.-1697G>A, XM_005254185.1:c.-1697G>A, XM_005254186.1:c.-1973G>A, XM_005254187.1:c.-1697G>A, XM_005254188.1:c.-1697G>A, XM_005254189.1:c.-1888G>A
          5.

          rs1378942 [Homo sapiens]
            AATCAAGAAAATGAGTACATTCATG[G/T]TTTCCCTATAATGAGCTCAGATTCA
            Chromosome:
            15:74785026
            Gene:
            CSK (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2446/1225
            HGVS:
            NC_000015.10:g.74785026C>A, NC_000015.9:g.75077367C>A, NM_001127190.1:c.-66+2306C>A, NM_004383.2:c.-66+2306C>A, XM_005254165.1:c.-66+503C>A, XM_005254165.3:c.-66+503C>A
            6.

            rs1051730 [Homo sapiens]
              GGGCCATCATCAAAGCCCCAGGCTA[C/T]AAACACGACATCAAGTACAACTGCT
              Chromosome:
              15:78601997
              Gene:
              CHRNA3 (GeneView)
              Functional Consequence:
              nc transcript variant,synonymous codon
              Allele Origin:
              T(germline)/C(germline)
              Clinical significance:
              drug-response
              Validated:
              no info
              Global MAF:
              A=0.1681/842
              HGVS:
              NC_000015.10:g.78601997G>A, NC_000015.9:g.78894339G>A, NG_016143.1:g.24299C>T, NM_000743.4:c.645C>T, NM_001166694.1:c.645C>T, NP_000734.2:p.Tyr215, NP_001160166.1:p.Tyr215, NR_046313.1:n.1146C>T, XM_006720382.1:c.444C>T, XM_011521173.1:c.564C>T, XP_006720445.1:p.Tyr148, XP_011519475.1:p.Tyr188
              7.

              rs762551 [Homo sapiens]
                TGCTCAAAGGGTGAGCTCTGTGGGC[A/C]CAGGACGCATGGTAGATGGAGCTTA
                Chromosome:
                15:74749576
                Gene:
                CYP1A2 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                C=0.3702/1854
                HGVS:
                NC_000015.10:g.74749576C>A, NC_000015.9:g.75041917C>A, NG_008431.1:g.32035C>A, NM_000761.3:c.-9-154C>A, NM_000761.4:c.-9-154C>A

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Write to the Help Desk