Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 3

1.

rs4295627 [Homo sapiens]
    ATTATTAATTACACTGCAAAAGCCA[G/T]GGGAACTACTGAGCTATCATACACT
    Chromosome:
    8:129673211
    Gene:
    CCDC26 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    G=0.1879/941
    HGVS:
    NC_000008.10:g.130685457T>G, NC_000008.11:g.129673211T>G, NR_130917.1:n.312+6717A>C
    2.

    rs2297440 [Homo sapiens]
      GTCTGGTGGCACATGCCCAGGGTGA[C/T]GCTGGTGAGGGAGGACGCAAAGGAC
      Chromosome:
      20:63680946
      Gene:
      RTEL1-TNFRSF6B (GeneView) RTEL1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.2825/1415
      HGVS:
      NC_000020.10:g.62312299T>C, NC_000020.11:g.63680946T>C, NG_033901.1:g.28137T>C, NM_001283009.1:c.1191+227T>C, NM_001283010.1:c.522+227T>C, NM_016434.3:c.1191+227T>C, NM_032957.4:c.1263+227T>C, NR_037882.1:n.2018+227T>C, XM_005260207.1:c.1191+227T>C, XM_005260208.1:c.-1662T>C, XR_244119.1:n.1537+227T>C
      3.

      rs498872 [Homo sapiens]
        CTTACCTTGCAAAGCCAGCTCTTGG[C/T]CCAGGAGACTGGCTGGGGAGGCCCT
        Chromosome:
        11:118606652
        Gene:
        PHLDB1 (GeneView)
        Functional Consequence:
        upstream variant 2KB,utr variant 5 prime
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.2456/1230
        HGVS:
        NC_000011.10:g.118606652A>G, NC_000011.9:g.118477367A>G, NM_001144758.2:c.-1069A>G, NM_001144759.2:c.-1069A>G, NM_015157.3:c.-199A>G, NW_003871072.2:g.232090A>G, XM_005271466.1:c.-1069A>G, XM_006718796.2:c.-1069A>G, XM_011542708.1:c.-1069A>G, XM_011542709.1:c.-42A>G

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Write to the Help Desk