Display Settings:

Format

Send to:

Choose Destination
1.

rs1421085 [Homo sapiens]
    TAGCAGTTCAGGTCCTAAGGCATGA[C/T]ATTGATTAAGTGTCTGATGAGAATT
    Chromosome:
    16:53767042
    Gene:
    FTO (GeneView)
    Functional Consequence:
    intron variant
    Clinical significance:
    other
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    C=0.2286/1145
    HGVS:
    NC_000016.10:g.53767042T>C, NC_000016.9:g.53800954T>C, NG_012969.1:g.68080T>C, NM_001080432.2:c.46-43098T>C, XM_011523313.1:c.46-43098T>C, XM_011523314.1:c.46-43098T>C, XM_011523315.1:c.46-43098T>C, XM_011523316.1:c.46-43098T>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk