Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 7

1.

rs281875284 [Homo sapiens]
    CGAAATGTGTGTTTTAAGGTGAAGA[C/T]TACAGCACCACGTAGGTACTGTGTG
    Chromosome:
    20:58418289
    Gene:
    VAPB (GeneView)
    Functional Consequence:
    missense,nc transcript variant
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    no info
    HGVS:
    NC_000020.10:g.56993345C>T, NC_000020.11:g.58418289C>T, NG_008073.2:g.34101C>T, NM_001195677.1:c.137C>T, NM_004738.4:c.137C>T, NP_001182606.1:p.Thr46Ile, NP_004729.1:p.Thr46Ile, NR_036633.1:n.478C>T
    2.

    rs6100067 [Homo sapiens]
      TAATAAAATAAATGGTTTAGTTTGC[C/T]GGGTTTTTTTTTAAGCCAGTCGGAC
      Chromosome:
      20:58442455
      Gene:
      VAPB (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.2963/1484
      HGVS:
      NC_000020.10:g.57017511C>T, NC_000020.11:g.58442455C>T, NG_008073.2:g.58267C>T, NM_001195677.1:c.212-1622C>T, NM_004738.4:c.573+1372C>T, NR_036633.1:n.729+1372C>T
      3.

      rs6026256 [Homo sapiens]
        GCAAACTCTTATTCCCTGCATCTCG[G/T]CTCTCTCATTATGGTGCACCCATGC
        Chromosome:
        20:58419347
        Gene:
        VAPB (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.2736/1370
        HGVS:
        NC_000020.10:g.56994403T>G, NC_000020.11:g.58419347T>G, NG_008073.2:g.35159T>G, NM_001195677.1:c.211+984T>G, NM_004738.4:c.211+984T>G, NR_036633.1:n.552+984T>G
        4.

        rs6026230 [Homo sapiens]
          CCCTCATGCTGTCTCCTGGTTGCGG[C/T]GCAAGGAGGCTGCCACGGTGCTGGG
          Chromosome:
          20:58390228
          Gene:
          VAPB (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.3035/1520
          HGVS:
          NC_000020.10:g.56965284T>C, NC_000020.11:g.58390228T>C, NG_008073.2:g.6040T>C, NM_001195677.1:c.58+711T>C, NM_004738.4:c.58+711T>C, NR_036633.1:n.399+711T>C
          5.

          rs2234489 [Homo sapiens]
            AATATTGAAATCTCAGCAGACTTCA[A/G]TTCTTTATTTGATATACATCAGGGC
            Chromosome:
            20:58438817
            Gene:
            VAPB (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2083/1043
            HGVS:
            NC_000020.10:g.57013873G>A, NC_000020.11:g.58438817G>A, NG_008073.2:g.54629G>A, NM_001195677.1:c.212-5260G>A, NM_004738.4:c.316-128G>A, NR_036633.1:n.553-2090G>A
            6.

            rs2234487 [Homo sapiens]
              GAATGCTTCTTATTTTTTTCAGTAA[C/T]AATAATTTAAAAAACCAATTAGATA
              Chromosome:
              20:58434740
              Gene:
              VAPB (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency
              Global MAF:
              T=0.4169/2088
              HGVS:
              NC_000020.10:g.57009796C>T, NC_000020.11:g.58434740C>T, NG_008073.2:g.50552C>T, NM_001195677.1:c.212-9337C>T, NM_004738.4:c.315+35C>T, NR_036633.1:n.553-6167C>T
              7.

              rs1802459 [Homo sapiens]
                TTCTGTTTGACTATGTAGCATCTTG[A/G]AAAGAAAAATTATAATAAAGCCCCA
                Chromosome:
                20:58445517
                Gene:
                VAPB (GeneView)
                Functional Consequence:
                nc transcript variant,utr variant 3 prime
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.1803/903
                HGVS:
                NC_000020.10:g.57020573A>G, NC_000020.11:g.58445517A>G, NG_008073.2:g.61329A>G, NM_001195677.1:c.*1352A>G, NM_004738.4:c.*1282A>G, NR_036633.1:n.2170A>G

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Write to the Help Desk