Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 16

3.

rs4460629 [Homo sapiens]
    TATTTCTGTAGGATCTGGGCCTCTA[C/T]GGACAGGAATCCTGCCCTCCAGCTC
    Chromosome:
    1:155162859
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.3758/1882
    HGVS:
    NC_000001.10:g.155135335T>C, NC_000001.11:g.155162859T>C
    4.

    rs4072037 [Homo sapiens]
      CCCCTAAACCCGCAACAGTTGTTAC[A/G]GGTTCTGGTCATGCAAGCTCTACCC
      Chromosome:
      1:155192276
      Gene:
      MUC1 (GeneView)
      Functional Consequence:
      intron variant,synonymous codon
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.3712/1859
      HGVS:
      NC_000001.10:g.155162067C>T, NC_000001.11:g.155192276C>T, NG_029383.1:g.5640G>A, NM_001018016.2:c.93G>A, NM_001018017.2:c.66G>A, NM_001044390.2:c.66G>A, NM_001044391.2:c.66G>A, NM_001044392.2:c.93G>A, NM_001044393.2:c.66G>A, NM_001204285.1:c.66G>A, NM_001204286.1:c.93G>A, NM_001204287.1:c.93G>A, NM_001204288.1:c.93G>A, NM_001204289.1:c.93G>A, NM_001204290.1:c.59-29G>A, NM_001204291.1:c.93G>A, NM_001204292.1:c.93G>A, NM_001204293.1:c.66G>A, NM_001204294.1:c.66G>A, NM_001204295.1:c.93G>A, NM_001204296.1:c.93G>A, NM_001204297.1:c.93G>A, NM_002456.5:c.66G>A, NP_001018016.1:p.Thr31, NP_001018017.1:p.Thr22, NP_001037855.1:p.Thr22, NP_001037856.1:p.Thr22, NP_001037857.1:p.Thr31, NP_001037858.1:p.Thr22, NP_001191214.1:p.Thr22, NP_001191215.1:p.Thr31, NP_001191216.1:p.Thr31, NP_001191217.1:p.Thr31, NP_001191218.1:p.Thr31, NP_001191220.1:p.Thr31, NP_001191221.1:p.Thr31, NP_001191222.1:p.Thr22, NP_001191223.1:p.Thr22, NP_001191224.1:p.Thr31, NP_001191225.1:p.Thr31, NP_001191226.1:p.Thr31, NP_002447.4:p.Thr22, XM_005245177.1:c.93G>A, XM_005245178.1:c.66G>A, XM_005245179.1:c.66G>A, XM_005245180.1:c.-11G>A, XM_005245181.1:c.93G>A, XM_005245182.1:c.93G>A, XM_005245183.1:c.-11G>A, XM_005245184.1:c.59-29G>A, XM_005245185.1:c.66G>A, XM_005245186.1:c.93G>A, XM_005245187.1:c.66G>A, XM_005245188.1:c.-141G>A, XM_005245189.1:c.66G>A, XM_005245190.1:c.66G>A, XM_005245191.1:c.93G>A, XM_005245192.1:c.66G>A, XM_005245193.1:c.59-29G>A, XM_005245194.1:c.93G>A, XP_005245234.1:p.Thr31, XP_005245235.1:p.Thr22, XP_005245236.1:p.Thr22, XP_005245238.1:p.Thr31, XP_005245239.1:p.Thr31, XP_005245242.1:p.Thr22, XP_005245243.1:p.Thr31, XP_005245244.1:p.Thr22, XP_005245246.1:p.Thr22, XP_005245247.1:p.Thr22, XP_005245248.1:p.Thr31, XP_005245249.1:p.Thr22, XP_005245251.1:p.Thr31, XR_241082.1:n.216G>A
      5.

      rs3782886 [Homo sapiens]
        TTTGCCAGCTAGTGTATGTGGAAAG[A/G]GCTGAAGTGCTCAAATCTGAAGATG
        Chromosome:
        12:111672685
        Gene:
        BRAP (GeneView)
        Functional Consequence:
        missense,synonymous codon
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.0355/178
        HGVS:
        NC_000012.11:g.112110489T>C, NC_000012.12:g.111672685T>C, NM_006768.4:c.723A>G, NP_006759.3:p.Arg241, XM_005253944.1:c.846A>G, XM_005253944.3:c.846A>G, XM_011538788.1:c.276A>G, XM_011538789.1:c.11A>G, XP_005254001.1:p.Arg282, XP_011537090.1:p.Arg92, XP_011537091.1:p.Glu4Gly
        8.

        rs2920297 [Homo sapiens]
          GAGCTCAGGGATGGGGAGGGACAGA[C/T]GGGTGGAGGAGTGGAAGATGGAGGA
          Chromosome:
          8:142681665
          Gene:
          PSCA (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4016/2011
          HGVS:
          NC_000008.10:g.143763083A>G, NC_000008.11:g.142681665A>G, NG_011722.3:g.16358A>G, NM_005672.4:c.133+231A>G, NR_033343.1:n.369+231A>G, NW_003871066.2:g.51798A>G
          9.

          rs2294008 [Homo sapiens]
            CTCCACCACAGCCCACCAGTGACCA[C/T]GAAGGCTGTGCTGCTTGCCCTGTTG
            Chromosome:
            8:142680513
            Gene:
            PSCA (GeneView)
            Functional Consequence:
            intron variant,utr variant 5 prime
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.4052/2029
            HGVS:
            NC_000008.10:g.143761931C>T, NC_000008.11:g.142680513C>T, NG_011722.3:g.15206C>T, NM_005672.4:c.-26C>T, NR_033343.1:n.262-814C>T, NW_003871066.2:g.50646C>T
            12.

            rs1159918 [Homo sapiens]
              ATCCCCTTTGCTGTGACTAATTGGG[G/T]GTCTGATTCTCTGCTGTAAAGACAA
              Chromosome:
              4:99321852
              Gene:
              ADH1B (GeneView)
              Functional Consequence:
              upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              A=0.4515/2261
              HGVS:
              NC_000004.11:g.100243009A>C, NC_000004.12:g.99321852A>C, NG_011435.1:g.4564T>G, NM_000668.5:c.-521T>G, NM_001286650.1:c.-763T>G, XM_005262730.1:c.-763T>G
              13.

              rs1042026 [Homo sapiens]
                TCACATTTACAAGTAGTGAAGGTCC[A/G]AGAGTTCTAAATACAGGAAATTTCT
                Chromosome:
                4:99307309
                Gene:
                ADH1B (GeneView)
                Functional Consequence:
                utr variant 3 prime
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                C=0.3670/1838
                HGVS:
                NC_000004.11:g.100228466T>C, NC_000004.12:g.99307309T>C, NG_011435.1:g.19107A>G, NM_000668.5:c.*531A>G, NM_001286650.1:c.*531A>G, XM_005262730.1:c.*531A>G
                16.

                rs671 [Homo sapiens]
                  CGAGTACGGGCTGCAGGCATACACT[A/G]AAGTGAAAACTGTGAGTGTGGGACC
                  Chromosome:
                  12:111803962
                  Gene:
                  ALDH2 (GeneView)
                  Functional Consequence:
                  missense
                  Allele Origin:
                  G(germline)/A(germline)
                  Clinical significance:
                  Pathogenic
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.0357/179
                  HGVS:
                  NC_000012.11:g.112241766G>A, NC_000012.12:g.111803962G>A, NG_012250.1:g.42421G>A, NM_000690.3:c.1510G>A, NM_001204889.1:c.1369G>A, NP_000681.2:p.Glu504Lys, NP_001191818.1:p.Glu457Lys

                  Display Settings:

                  Format
                  Items per page
                  Sort by

                  Send to:

                  Choose Destination

                  Supplemental Content

                  Find related data

                  Recent activity

                  Your browsing activity is empty.

                  Activity recording is turned off.

                  Turn recording back on

                  See more...
                  Write to the Help Desk