Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 20

1.

rs55902142 [Homo sapiens]
    AAAAAGGAGACCCTGGAAAAAGTCC[A/G]GGTAAGGACCCCAGCAAGGTCTGAG
    Chromosome:
    10:52770671
    Gene:
    MBL2 (GeneView)
    Functional Consequence:
    synonymous codon
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000010.10:g.54530431C>T, NC_000010.11:g.52770671C>T, NG_008196.1:g.6030G>A, NM_000242.2:c.303G>A, NP_000233.1:p.Pro101, XM_005269844.1:c.303G>A, XM_006717861.2:c.303G>A, XM_011539816.1:c.303G>A, XP_005269901.1:p.Pro101, XP_006717924.1:p.Pro101, XP_011538118.1:p.Pro101
    2.

    rs17587392 [Homo sapiens]
      GATGCAATTGTGAGCCAGGCCTCAG[C/T]GGCAAAAAGGCATGGGACAAGTACC
      Chromosome:
      10:52751488
      Gene:
      LOC105378305 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.0439/220
      HGVS:
      NC_000010.10:g.54511248T>C, NC_000010.11:g.52751488T>C, XR_945961.1:n.259+3818A>G, XR_945962.1:n.259+3818A>G
      3.

      rs11003138 [Homo sapiens]
        TCCTTTTTTTTAGTAAGTCTATAAA[C/T]CCACATTCCAAAATATGCCAGGGCT
        Chromosome:
        10:52787413
        Gene:
        LOC105378307 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.4619/2313
        HGVS:
        NC_000010.10:g.54547173T>C, NC_000010.11:g.52787413T>C, XR_945965.1:n.365-3079A>G
        4.

        rs11003132 [Homo sapiens]
          ATACCGCAGAGAGGTGCTCACCTTT[C/T]GAGGCTTACCAAAAGCCATGGCACA
          Chromosome:
          10:52777687
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.1857/930
          HGVS:
          NC_000010.10:g.54537447C>T, NC_000010.11:g.52777687C>T
          5.

          rs11003125 [Homo sapiens]
            GAGTTTGCTTCCCCTTGGTGTTTTA[C/G]ACAGGCTTGCCTGGGTAAGCATTTT
            Chromosome:
            10:52772254
            Gene:
            MBL2 (GeneView)
            Functional Consequence:
            intron variant,upstream variant 2KB
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.3061/1533
            HGVS:
            NC_000010.10:g.54532014G>C, NC_000010.11:g.52772254G>C, NG_008196.1:g.4447C>G, NM_000242.2:c.-619C>G, XM_005269844.1:c.-10+483C>G, XM_006717861.2:c.-25+483C>G, XM_011539816.1:c.-10+483C>G
            6.

            rs11003120 [Homo sapiens]
              ATTCTGTGTTTTCTCATAGAATGGA[C/T]GATTTTAGTAGAAAACAAGTTTGTA
              Chromosome:
              10:52762874
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.1350/676
              HGVS:
              NC_000010.10:g.54522634C>T, NC_000010.11:g.52762874C>T
              7.

              rs11003107 [Homo sapiens]
                GAATGTCATTTCCTTTTTCTAGAAC[C/T]GGGGAGGAAAACAGAGGACTAAAGC
                Chromosome:
                10:52747567
                Gene:
                LOC105378305 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.0705/353
                HGVS:
                NC_000010.10:g.54507327C>T, NC_000010.11:g.52747567C>T, XR_945961.1:n.259+7739G>A, XR_945962.1:n.259+7739G>A
                8.

                rs10824804 [Homo sapiens]
                  ACTTAGAAGACAGCAATTTTAAGAG[A/C]AGGAATATTGTCAGTATTCAAGTTT
                  Chromosome:
                  10:52793045
                  Gene:
                  LOC105378306 (GeneView) LOC105378307 (GeneView)
                  Functional Consequence:
                  downstream variant 500B,intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.4193/2100
                  HGVS:
                  NC_000010.10:g.54552805A>C, NC_000010.11:g.52793045A>C, XR_945963.1:n.39+2727A>C, XR_945965.1:n.365-8711T>G, XR_945966.1:n.792T>G
                  9.

                  rs10824793 [Homo sapiens]
                    TGACGAAAAAGATTGCAGAGTTTTT[A/G]TCTTTGGAGAGGTTTTGCTTTTGAT
                    Chromosome:
                    10:52769720
                    Gene:
                    MBL2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.4758/2383
                    HGVS:
                    NC_000010.10:g.54529480G>A, NC_000010.11:g.52769720G>A, NG_008196.1:g.6981C>T, NM_000242.2:c.305-405C>T, XM_005269844.1:c.305-405C>T, XM_006717861.2:c.305-405C>T, XM_011539816.1:c.305-405C>T
                    10.

                    rs10762885 [Homo sapiens]
                      AGGGCCCAGCCAGTAGCTATCAGTC[A/G]ACCAGCTTTCCTCAGATCACTCCCT
                      Chromosome:
                      10:52785830
                      Gene:
                      LOC105378307 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.4131/2069
                      HGVS:
                      NC_000010.10:g.54545590G>A, NC_000010.11:g.52785830G>A, XR_945965.1:n.365-1496C>T
                      11.

                      rs10082466 [Homo sapiens]
                        CAAAAATGTGAACGGGTACTTCACA[A/G]AAGAAGATACCCAAGTGCCCAATAA
                        Chromosome:
                        10:52766862
                        Gene:
                        MBL2 (GeneView)
                        Functional Consequence:
                        utr variant 3 prime
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.2770/1387
                        HGVS:
                        NC_000010.10:g.54526622A>G, NC_000010.11:g.52766862A>G, NG_008196.1:g.9839T>C, NM_000242.2:c.*1275T>C, XM_006717861.2:c.*1275T>C, XM_011539816.1:c.*1275T>C
                        12.

                        rs7096206 [Homo sapiens]
                          GCTGGAAGACTATAAACATGCTTTC[C/G]GTGGCAGTGAGAACAAATGGGACCG
                          Chromosome:
                          10:52771925
                          Gene:
                          MBL2 (GeneView)
                          Functional Consequence:
                          intron variant,upstream variant 2KB
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.1955/979
                          HGVS:
                          NC_000010.10:g.54531685G>C, NC_000010.11:g.52771925G>C, NG_008196.1:g.4776C>G, NM_000242.2:c.-290C>G, XM_005269844.1:c.-9-281C>G, XM_006717861.2:c.-24-266C>G, XM_011539816.1:c.-9-281C>G
                          13.

                          rs7095891 [Homo sapiens]
                            CTCAGTTAATGAACACATATTTACC[A/G]AGCATGCCCTCTGTCCTACAATCTG
                            Chromosome:
                            10:52771701
                            Gene:
                            MBL2 (GeneView)
                            Functional Consequence:
                            intron variant,upstream variant 2KB
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.2833/1419
                            HGVS:
                            NC_000010.10:g.54531461G>A, NC_000010.11:g.52771701G>A, NG_008196.1:g.5000C>T, NM_000242.2:c.-66C>T, XM_005269844.1:c.-9-57C>T, XM_006717861.2:c.-24-42C>T, XM_011539816.1:c.-9-57C>T
                            14.

                            rs5030737 [Homo sapiens]
                              CAACGGCTTCCCAGGCAAAGATGGG[C/T]GTGATGGCACCAAGGGAGAAAAGGG
                              Chromosome:
                              10:52771482
                              Gene:
                              MBL2 (GeneView)
                              Functional Consequence:
                              missense
                              Allele Origin:
                              T(germline)/C(germline)
                              Clinical significance:
                              Pathogenic
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.0272/136
                              HGVS:
                              NC_000010.10:g.54531242G>A, NC_000010.11:g.52771482G>A, NG_008196.1:g.5219C>T, NM_000242.2:c.154C>T, NP_000233.1:p.Arg52Cys, XM_005269844.1:c.154C>T, XM_006717861.2:c.154C>T, XM_011539816.1:c.154C>T, XP_005269901.1:p.Arg52Cys, XP_006717924.1:p.Arg52Cys, XP_011538118.1:p.Arg52Cys
                              15.

                              rs1838065 [Homo sapiens]
                                CAAAGAATGAAAAATCGCTATTTCC[A/G]TCCAACCCCAAATGTCCCTCTTTGT
                                Chromosome:
                                10:52769497
                                Gene:
                                MBL2 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                G=0.3061/1533
                                HGVS:
                                NC_000010.10:g.54529257A>G, NC_000010.11:g.52769497A>G, NG_008196.1:g.7204T>C, NM_000242.2:c.305-182T>C, XM_005269844.1:c.305-182T>C, XM_006717861.2:c.305-182T>C, XM_011539816.1:c.305-182T>C
                                16.

                                rs1800451 [Homo sapiens]
                                  AAAGATGGGYGTGATGRCACCAAGG[A/G]AGAAAAGGGGGAACCAGGTACGTGT
                                  Chromosome:
                                  10:52771466
                                  Gene:
                                  MBL2 (GeneView)
                                  Functional Consequence:
                                  missense
                                  Allele Origin:
                                  G(germline)/A(germline)
                                  Clinical significance:
                                  Pathogenic
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  T=0.0813/407
                                  HGVS:
                                  NC_000010.10:g.54531226C>T, NC_000010.11:g.52771466C>T, NG_008196.1:g.5235G>A, NM_000242.2:c.170G>A, NP_000233.1:p.Gly57Glu, XM_005269844.1:c.170G>A, XM_006717861.2:c.170G>A, XM_011539816.1:c.170G>A, XP_005269901.1:p.Gly57Glu, XP_006717924.1:p.Gly57Glu, XP_011538118.1:p.Gly57Glu
                                  17.

                                  rs1800450 [Homo sapiens]
                                    TTCCCAGGCAAAGATGGGCGTGATG[A/G]CACCAAGGGAGAAAAGGGGGAACCA
                                    Chromosome:
                                    10:52771475
                                    Gene:
                                    MBL2 (GeneView)
                                    Functional Consequence:
                                    missense
                                    Allele Origin:
                                    G(germline)/A(germline)
                                    Clinical significance:
                                    Pathogenic
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    T=0.1220/611
                                    HGVS:
                                    NC_000010.10:g.54531235C>T, NC_000010.11:g.52771475C>T, NG_008196.1:g.5226G>A, NM_000242.2:c.161G>A, NP_000233.1:p.Gly54Asp, XM_005269844.1:c.161G>A, XM_006717861.2:c.161G>A, XM_011539816.1:c.161G>A, XP_005269901.1:p.Gly54Asp, XP_006717924.1:p.Gly54Asp, XP_011538118.1:p.Gly54Asp
                                    18.

                                    rs930507 [Homo sapiens]
                                      CAACTTGTTTGCCCAGAGAGAAGGT[C/G]AGCCCTAAAATGTGAAAAAGTGGGT
                                      Chromosome:
                                      10:52768506
                                      Gene:
                                      MBL2 (GeneView)
                                      Functional Consequence:
                                      synonymous codon
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      G=0.2612/1308
                                      HGVS:
                                      NC_000010.10:g.54528266G>C, NC_000010.11:g.52768506G>C, NG_008196.1:g.8195C>G, NM_000242.2:c.378C>G, NP_000233.1:p.Leu126, XM_005269844.1:c.378C>G, XM_006717861.2:c.378C>G, XM_011539816.1:c.378C>G, XP_005269901.1:p.Leu126, XP_006717924.1:p.Leu126, XP_011538118.1:p.Leu126
                                      19.

                                      rs920727 [Homo sapiens]
                                        GCCTGGGTGTCAGCTCTGGAATGTA[C/T]TTGAAATTGTGCCTTGCCTCTGCTG
                                        Chromosome:
                                        10:52759208
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                        Global MAF:
                                        C=0.3648/1827
                                        HGVS:
                                        NC_000010.10:g.54518968C>T, NC_000010.11:g.52759208C>T
                                        20.

                                        rs172881 [Homo sapiens]
                                          tttgttggctgtttgtacacttgat[C/T]ttagccaaaaggccaagaGCAAATG
                                          Chromosome:
                                          5:41107378
                                          Gene:
                                          LOC105374739 (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000005.10:g.41107378C>T, NC_000005.9:g.41107480C>T, XR_925944.1:n.618-5250C>T, XR_925945.1:n.125-5250C>T, XR_925946.1:n.576-5250C>T, XR_925948.1:n.618-5250C>T

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Write to the Help Desk