Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 11

1.

rs12029406 [Homo sapiens]
    CACCAAATCTTTGAACAAGGATCTG[C/T]CTAGAATACTACCCATGCTATGCAC
    Chromosome:
    1:199936700
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.4569/2288
    HGVS:
    NC_000001.10:g.199905828C>T, NC_000001.11:g.199936700C>T
    2.

    rs10919791 [Homo sapiens]
      CTCCAGAGTAGCTGGGATCATAGGC[A/G]CATACCACTGTACCTGGCTAATTTC
      Chromosome:
      1:199996040
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.3464/1735
      HGVS:
      NC_000001.10:g.199965168G>A, NC_000001.11:g.199996040G>A
      3.

      rs9564966 [Homo sapiens]
        GTTACATTACAGAACTTCCTTGATG[A/G]GGAAGGGGCCCTAGTGATCTTTCTG
        Chromosome:
        13:73322084
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.4888/2448
        HGVS:
        NC_000013.10:g.73896221A>G, NC_000013.11:g.73322084A>G
        4.

        rs9543325 [Homo sapiens]
          GATGCACGTGCTGCCCTTGCTGCAC[C/T]TCTATCACACCTGTGCCTTCTCTAT
          Chromosome:
          13:73342491
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.4595/2301
          HGVS:
          NC_000013.10:g.73916628C>T, NC_000013.11:g.73342491C>T
          5.

          rs4635969 [Homo sapiens]
            agattaatgacaggccaagaaacaa[C/T]gaaaacaatacagatttcttgtagg
            Chromosome:
            5:1308437
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.1859/931
            HGVS:
            NC_000005.10:g.1308437G>A, NC_000005.9:g.1308552G>A
            6.

            rs4465241 [Homo sapiens]
              GCTTTTGCTAACTTCTAGATGGTGC[C/T]GAACCTATCACTTAGTCTCACTGTG
              Chromosome:
              1:199994494
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.1134/568
              HGVS:
              NC_000001.10:g.199963622T>C, NC_000001.11:g.199994494T>C
              7.

              rs3790844 [Homo sapiens]
                CCAAGATCATCTAAGCGACAGACTT[C/T]CCAGTTTTAGTGACCTGTGTTTCCA
                Chromosome:
                1:200038304
                Gene:
                NR5A2 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.3550/1778
                HGVS:
                NC_000001.10:g.200007432A>G, NC_000001.11:g.200038304A>G, NM_003822.4:c.65-5470A>G, NM_205860.2:c.65-1354A>G, XM_005245061.1:c.65-397A>G, XM_011509380.1:c.-56-1354A>G, XM_011509381.1:c.-525A>G, XM_011509382.1:c.-14-5470A>G, XM_011509384.1:c.-853A>G
                8.

                rs3790843 [Homo sapiens]
                  AGATGCTCTGGTGCAGCCGAAGTAG[A/G]CGTTTGGGGAGGCGAACTCATCGGG
                  Chromosome:
                  1:200041696
                  Gene:
                  NR5A2 (GeneView)
                  Functional Consequence:
                  intron variant,upstream variant 2KB
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.3964/1985
                  HGVS:
                  NC_000001.10:g.200010824C>T, NC_000001.11:g.200041696C>T, NM_001276464.1:c.-1284C>T, NM_003822.4:c.65-2078C>T, NM_205860.2:c.202+1901C>T, XM_005245061.1:c.274+1901C>T, XM_005245062.1:c.-1317C>T, XM_005245062.2:c.-1317C>T, XM_011509380.1:c.82+1901C>T, XM_011509381.1:c.82+1901C>T, XM_011509382.1:c.-14-2078C>T, XM_011509383.1:c.-15+759C>T, XM_011509384.1:c.82+1901C>T
                  9.

                  rs505922 [Homo sapiens]
                    TCAAGATGTATCCAGCTGTACCTTT[C/T]ATGTGCGGTTTATTGTATACATCCG
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.3540/1773
                    HGVS:
                    NC_000009.11:g.136149229T>C, NG_006669.1:g.3822A>G, NM_020469.2:c.28+1350A>G, XM_005276848.1:c.28+1349A>G, XM_005276851.1:c.-261+1349A>G
                    10.

                    rs402710 [Homo sapiens]
                      GGAGCAACGGCCGAGCATACGCAGC[C/T]GCACTCACCACCGCTGGTACAGGTA
                      Chromosome:
                      5:1320607
                      Gene:
                      CLPTM1L (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.3359/1682
                      HGVS:
                      NC_000005.10:g.1320607C>T, NC_000005.9:g.1320722C>T, NM_030782.4:c.1532+9G>A, NT_187547.1:g.193402G>A, XM_005248379.1:c.1529+9G>A, XM_005248380.1:c.1424+9G>A, XM_011514144.1:c.1529+9G>A
                      11.

                      rs401681 [Homo sapiens]
                        CTGCTATCCAGACAACTTCAGAGTC[C/T]ATCATGGTGTGAAGCAGCTTTCTGG
                        Chromosome:
                        5:1321972
                        Gene:
                        CLPTM1L (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        T=0.4107/2057
                        HGVS:
                        NC_000005.10:g.1321972C>T, NC_000005.9:g.1322087C>T, NM_030782.4:c.1316-153G>A, NT_187547.1:g.192037G>A, XM_005248379.1:c.1313-153G>A, XM_005248380.1:c.1208-153G>A, XM_011514144.1:c.1313-153G>A

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Write to the Help Desk