Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 5

1.

rs6703669 [Homo sapiens]
    TGGCTGGCTGTAATGTATGAATTTA[C/T]TCCAAACCATCCCTGGGGCCAAGAT
    Chromosome:
    1:46396883
    Gene:
    FAAH (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1312/657
    HGVS:
    NC_000001.10:g.46862555C>T, NC_000001.11:g.46396883C>T, NG_012195.1:g.7617C>T, NM_001441.2:c.195+2340C>T, XM_005270624.1:c.195+2340C>T, XM_005270625.1:c.195+2340C>T, XR_246250.1:n.273+2340C>T
    2.

    rs3766346 [Homo sapiens]
      AGAATGTCCAGAATTGTAATTTCTC[C/T]AATAAAAAAACTCAGATTTGAATCA
      Chromosome:
      1:78515594
      Gene:
      PTGFR (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1837/920
      HGVS:
      NC_000001.10:g.78981279G>A, NC_000001.11:g.78515594G>A, NM_000959.3:c.799-20812G>A, NM_001039585.1:c.869+17650G>A, XM_006710781.2:c.799-20812G>A, XR_426624.2:n.1346+11517G>A
      3.

      rs3766246 [Homo sapiens]
        GTTCAAGACTTCTCCCCAAACACAC[C/T]AGATAATCCTCTTGATATATTCTTT
        Chromosome:
        1:46399999
        Gene:
        FAAH (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.4345/2176
        HGVS:
        NC_000001.10:g.46865671A>G, NC_000001.11:g.46399999A>G, NG_012195.1:g.10733A>G, NM_001441.2:c.196-2092A>G, XM_005270624.1:c.196-2092A>G, XM_005270625.1:c.196-2092A>G, XR_246250.1:n.274-2092A>G
        4.

        rs2295633 [Homo sapiens]
          CCCTCTATATACTTGTCCCACAGGG[C/T]CACAGTTCACCCCGACGACAACATC
          Chromosome:
          1:46408711
          Gene:
          FAAH (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          A=0.3950/1978
          HGVS:
          NC_000001.10:g.46874383A>G, NC_000001.11:g.46408711A>G, NG_012195.1:g.19445A>G, NM_001441.2:c.1077+127A>G, XM_005270624.1:c.1077+127A>G, XM_005270625.1:c.1077+127A>G, XR_246250.1:n.1237+127A>G
          5.

          rs324420 [Homo sapiens]
            CTGTGAGACTCAGCTGTCTCAGGCC[A/C]CAAGGCAGGGCCTGCTCTATGGCGT
            Chromosome:
            1:46405089
            Gene:
            FAAH (GeneView)
            Functional Consequence:
            missense
            Allele Origin:
            A(germline)/C(germline)
            Clinical significance:
            other
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            A=0.2616/1310
            HGVS:
            NC_000001.10:g.46870761C>A, NC_000001.11:g.46405089C>A, NG_012195.1:g.15823C>A, NM_001441.2:c.385C>A, NP_001432.2:p.Pro129Thr, XM_005270624.1:c.385C>A, XM_005270625.1:c.385C>A, XP_005270681.1:p.Pro129Thr, XP_005270682.1:p.Pro129Thr, XR_246250.1:n.463C>A

            Display Settings:

            Format
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Write to the Help Desk