Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 31

1.

rs17305573 [Homo sapiens]
    GAACAGAATTTGTTAAAACAGAAAA[C/T]AAAGGTACAATATAAGGAATCAACA
    Chromosome:
    20:34592348
    Gene:
    PIGU (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0142/71
    HGVS:
    NC_000020.10:g.33180152T>C, NC_000020.11:g.34592348T>C, NG_011497.1:g.89938A>G, NM_080476.4:c.628-3741A>G, XM_005260279.1:c.628-3741A>G, XM_005260280.1:c.568-3741A>G, XM_011528542.1:c.-21-3741A>G
    2.

    rs12918773 [Homo sapiens]
      agcaagtcccaaatgcttctcccat[A/G]tccaagaaaaatgaaggtatgcaga
      Chromosome:
      16:89674995
      Gene:
      CDK10 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0793/397
      HGVS:
      NC_000016.10:g.89674995G>A, NC_000016.9:g.89741403G>A, XM_011523409.1:c.-1092+1702G>A, XM_011523418.1:c.-1092+1702G>A, XR_933471.1:n.855+1702G>A
      4.

      rs10830253 [Homo sapiens]
        AGCTAACATTTAATTGAGTACACAC[G/T]ATATACCAGGCCCTGAATCACTTAC
        Chromosome:
        11:89294875
        Gene:
        TYR (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.2242/1123
        HGVS:
        NC_000011.10:g.89294875T>G, NC_000011.9:g.89028043T>G, NG_008748.1:g.122004T>G, NM_000372.4:c.1367-268T>G, XM_011542970.1:c.*45-268T>G
        5.

        rs10757257 [Homo sapiens]
          AGGGAGGAAGCCACCTGGAGTGAGA[A/G]TAATTCAAGCAATCTTTTTTGTGGT
          Chromosome:
          9:21806565
          Gene:
          MTAP (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.3171/1588
          HGVS:
          NC_000009.11:g.21806564G>A, NC_000009.12:g.21806565G>A, NG_032650.1:g.8930G>A, NM_002451.3:c.33+3784G>A, XM_005251463.1:c.33+3784G>A, XM_005251464.1:c.33+3784G>A, XM_005251465.1:c.84+3615G>A, XM_005251466.1:c.84+3615G>A, XR_242508.1:n.140+3784G>A
          6.

          rs8059973 [Homo sapiens]
            TGGTTCTGTGTTAATAATGACagct[A/G]ggtgtggtggtgcacacctgtgtgg
            Chromosome:
            16:90013126
            Gene:
            DBNDD1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.3361/1683
            HGVS:
            NC_000016.10:g.90013126A>G, NC_000016.9:g.90079534A>G, NM_001042610.2:c.32-3696T>C, NM_001288708.1:c.-82-1430T>C, NM_001288709.1:c.392-3696T>C
            7.

            rs7188458 [Homo sapiens]
              TTAACACAGGGATTTAATGTCTCAC[A/G]AATGAAGGGTCAGAGGTGGAGCTTC
              Chromosome:
              16:89660076
              Gene:
              SPATA33 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.4393/2200
              HGVS:
              NC_000016.10:g.89660076G>A, NC_000016.9:g.89726484G>A, NG_033005.1:g.2710C>T, NM_001271907.1:c.211+1655G>A, NM_001271908.1:c.118+1655G>A, NM_001271909.1:c.118+1655G>A, NM_001271910.1:c.211+1655G>A, NM_153025.2:c.208+1655G>A, NR_073515.1:n.406+1867G>A, NR_073516.1:n.376-464G>A, XM_006721133.2:c.212-464G>A
              8.

              rs7023329 [Homo sapiens]
                TGGTAACCTTGAGTCCTGTGAATCT[A/G]TGCCTGCAGAGGGATCAATAAGTAA
                Chromosome:
                9:21816529
                Gene:
                MTAP (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.4499/2253
                HGVS:
                NC_000009.11:g.21816528A>G, NC_000009.12:g.21816529A>G, NG_032650.1:g.18894A>G, NM_002451.3:c.121-185A>G, XM_005251463.1:c.121-185A>G, XM_005251464.1:c.121-185A>G, XM_005251465.1:c.172-185A>G, XM_005251466.1:c.172-185A>G, XR_242508.1:n.228-185A>G
                11.

                rs4785763 [Homo sapiens]
                  CTGCTGGGCCCCCGGCCCTTCTCGG[A/C]GAAGTCTACCTATGAGGAGTTTGTA
                  Chromosome:
                  16:90000528
                  Gene:
                  AFG3L1P (GeneView)
                  Functional Consequence:
                  nc transcript variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.2804/1404
                  HGVS:
                  NC_000016.10:g.90000528A>C, NC_000016.9:g.90066936A>C, NR_003228.1:n.1682A>C
                  12.

                  rs4636294 [Homo sapiens]
                    TCAAGACTTAAAAGGATTTAAGTCC[A/G/T]ATAGTAAAAGGAGCGAAGGGAATTC
                    Chromosome:
                    9:21747804
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.3934/1970
                    HGVS:
                    NC_000009.11:g.21747803A>G, NC_000009.12:g.21747804A>G
                    13.

                    rs4408545 [Homo sapiens]
                      GGTATTTAAGGCGATAAGCTCACAC[C/T]TCACCCTGCTTGCTCCAGTGGTTAT
                      Chromosome:
                      16:89977620
                      Gene:
                      AFG3L1P (GeneView)
                      Functional Consequence:
                      intron variant,nc transcript variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency
                      Global MAF:
                      T=0.3514/1760
                      HGVS:
                      NC_000016.10:g.89977620C>T, NC_000016.9:g.90044028C>T, NR_003226.1:n.202C>T, NR_003227.1:n.187-58C>T, NR_003228.1:n.187-19C>T
                      14.

                      rs4238833 [Homo sapiens]
                        CTCTTGAATTACATGCACAGGCCAG[G/T]CTAGAAATGTCCAAATCAGTCAGAA
                        Chromosome:
                        16:89984281
                        Gene:
                        AFG3L1P (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency
                        Global MAF:
                        G=0.3646/1826
                        HGVS:
                        NC_000016.10:g.89984281G>T, NC_000016.9:g.90050689G>T, NR_003226.1:n.700-250G>T, NR_003227.1:n.627-250G>T, NR_003228.1:n.666-250G>T
                        15.

                        rs2353033 [Homo sapiens]
                          CCTTCACCATGTAGAGTCCACCGTC[C/T]TGATCCCAGATGTGAGTCTGTGGCC
                          Chromosome:
                          16:89319153
                          Gene:
                          ANKRD11 (GeneView) LOC100287036 (GeneView)
                          Functional Consequence:
                          intron variant,upstream variant 2KB
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          T=0.4559/2283
                          HGVS:
                          NC_000016.10:g.89319153C>T, NC_000016.9:g.89385561C>T, NG_032003.1:g.176409G>A, NM_001242885.1:c.-2282C>T, NM_001256182.1:c.-59-2075G>A, NM_001256183.1:c.-56-2078G>A, NM_013275.5:c.-59-2075G>A, NR_045839.1:n.403-2075G>A, XM_006721181.1:c.-255-2078G>A, XM_011523051.1:c.-59-2075G>A, XM_011523052.1:c.-56-2078G>A, XM_011523053.1:c.-59-2075G>A, XM_011523054.1:c.-258-2075G>A, XM_011523055.1:c.-531-2075G>A, XM_011523056.1:c.-307-2075G>A, XM_011523057.1:c.-59-2075G>A
                          17.

                          rs2218220 [Homo sapiens]
                            CAACCTTCTTTGCACATTAGCACCC[C/T]TGGGATTTGGCATGATCCTATCAGT
                            Chromosome:
                            9:21756090
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            C=0.3914/1960
                            HGVS:
                            NC_000009.11:g.21756089C>T, NC_000009.12:g.21756090C>T
                            18.
                            19.

                            rs1847142 [Homo sapiens]
                              CTTTAACCCCTACATTGTCTTCTAC[A/G]CATATGCTCCACCTCTTTGTTCCTT
                              Chromosome:
                              11:89288406
                              Gene:
                              TYR (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              A=0.1931/967
                              HGVS:
                              NC_000011.10:g.89288406G>A, NC_000011.9:g.89021574G>A, NG_008748.1:g.115535G>A, NM_000372.4:c.1366+3452G>A, XM_011542970.1:c.1367-32G>A
                              20.

                              rs1806319 [Homo sapiens]
                                CAGTGTCACCATGTTTACCAGTTTG[A/G]GTTCTGTATTTCCTTTTAGTTGAAG
                                Chromosome:
                                11:89304768
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                C=0.3866/1936
                                HGVS:
                                NC_000011.10:g.89304768T>C, NC_000011.9:g.89037936T>C

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Write to the Help Desk