Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 5

1.

rs17327624 [Homo sapiens]
    CAGTGTATAGAATAGACACAAAACT[G/T]AGTCAATCATCATTCCCTCCTTTGT
    Chromosome:
    7:87587501
    Gene:
    ABCB1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1731/867
    HGVS:
    NC_000007.13:g.87216817G>T, NC_000007.14:g.87587501G>T, NG_011513.1:g.130748C>A, NM_000927.4:c.118-1821C>A
    2.

    rs17327442 [Homo sapiens]
      GCTAGTCTTCACAACTAGATCATCA[A/T]CTGTTTGGGAGCTCATGCATGCTAT
      Chromosome:
      7:87583674
      Gene:
      ABCB1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1853/928
      HGVS:
      NC_000007.13:g.87212990T>A, NC_000007.14:g.87583674T>A, NG_011513.1:g.134575A>T, NM_000927.4:c.286+1838A>T
      3.

      rs4148733 [Homo sapiens]
        TGGCGTTAGCTCTCTTACTGCTTCA[C/T]AGTGGAAGAATCAAATACTTCATCA
        Chromosome:
        7:87583916
        Gene:
        ABCB1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.1681/842
        HGVS:
        NC_000007.13:g.87213232A>G, NC_000007.14:g.87583916A>G, NG_011513.1:g.134333T>C, NM_000927.4:c.286+1596T>C
        4.

        rs2032582 [Homo sapiens]
          GAAAGATAAGAAAGAACTAGAAGGT[A/G/T]CTGGGAAGGTGAGTCAAACTAAATA
          Chromosome:
          7:87531302
          Gene:
          ABCB1 (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          G(germline)/T(germline)/A(germline)
          Clinical significance:
          drug-response
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.3343/1674
          HGVS:
          NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr
          5.

          rs1045642 [Homo sapiens]
            GCCGGGTGGTGTCACAGGAAGAGAT[C/T]GTGAGGGCAGCAAAGGAGGCCAACA
            Chromosome:
            7:87509329
            Gene:
            ABCB1 (GeneView)
            Functional Consequence:
            synonymous codon
            Clinical significance:
            drug-response
            Validated:
            no info
            Global MAF:
            A=0.3952/1979
            HGVS:
            NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NP_000918.2:p.Ile1145

            Display Settings:

            Format
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Write to the Help Desk