Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs1001179 [Homo sapiens]
    CGCCCCGCCGGCCCGGGGTGCCCGG[A/G]ATAGCCGAACCCAGGGCGGGGCTCC
    Chromosome:
    11:34438684
    Gene:
    CAT (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1256/629
    HGVS:
    NC_000011.10:g.34438684C>T, NC_000011.9:g.34460231C>T, NG_013339.1:g.4760C>T, NM_001752.3:c.-330C>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center