Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 48

1.

rs12753193 [Homo sapiens]
    GATGGCTGGGTCACTGGCCACCTGC[A/G]GTTGTCTTCTTTCTCTTCTCATTAC
    Chromosome:
    1:65703996
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4740/2374
    HGVS:
    NC_000001.10:g.66169679G>A, NC_000001.11:g.65703996G>A
    2.

    rs12427353 [Homo sapiens]
      CAGGACTCTCCCCTAACTCATAGGT[C/G]GGGGCTGGAAGCTTCACCATCCCCA
      Chromosome:
      12:120989098
      Gene:
      HNF1A (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.0625/313
      HGVS:
      NC_000012.11:g.121426901G>C, NC_000012.12:g.120989098G>C, NG_011731.2:g.15353G>C, NM_000545.5:c.526+66G>C, NM_000545.6:c.526+66G>C, NM_001306179.1:c.526+66G>C, XM_005253931.1:c.526+66G>C, XM_005253931.2:c.526+66G>C, XM_005253932.1:c.175+66G>C, XM_011538713.1:c.526+66G>C
      3.

      rs12093699 [Homo sapiens]
        GTTTTTCATTCTAATATGGAGCAGA[A/G]TGTGCTCTCTAGATGGTTATCTAGT
        Chromosome:
        1:159678198
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.2482/1243
        HGVS:
        NC_000001.10:g.159647988G>A, NC_000001.11:g.159678198G>A
        4.

        rs12022410 [Homo sapiens]
          CCCTCAGGAGATGCTTGGCTCCTGA[A/G]GTCCCTGAAGTTGGAGCACATTTAG
          Chromosome:
          1:65688250
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.3718/1862
          HGVS:
          NC_000001.10:g.66153933A>G, NC_000001.11:g.65688250A>G
          5.

          rs11265260 [Homo sapiens]
            GTTTTCTAATACAGATACATTCCAC[A/G]CAAATTTGATTTCAAATTTGAATTG
            Chromosome:
            1:159730249
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.0865/433
            HGVS:
            NC_000001.10:g.159700039A>G, NC_000001.11:g.159730249A>G
            6.

            rs11065385 [Homo sapiens]
              AGTACTTGGGAGTCCGAGGTGGGAG[A/G]ACCAATTGAGCCCAGGAGTTTGAGG
              Chromosome:
              12:120985583
              Gene:
              HNF1A (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.2961/1483
              HGVS:
              NC_000012.11:g.121423386A>G, NC_000012.12:g.120985583A>G, NG_011731.2:g.11838A>G, NM_000545.5:c.327-3250A>G, NM_000545.6:c.327-3250A>G, NM_001306179.1:c.327-3250A>G, XM_005253931.1:c.327-3250A>G, XM_005253931.2:c.327-3250A>G, XM_005253932.1:c.-25-3250A>G, XM_011538713.1:c.327-3250A>G
              7.

              rs10774579 [Homo sapiens]
                TGGAATCTGATTTTTTTTAACCCTG[C/T]GACTCTGGGAATTTATTTTTTGCAT
                Chromosome:
                12:120967407
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.4285/2146
                HGVS:
                NC_000012.11:g.121405210T>C, NC_000012.12:g.120967407T>C
                8.

                rs7979478 [Homo sapiens]
                  TCAGGAAAACAGTAGCCACGGCAGG[A/G]GGGGGGGGGGACAGAGGATCTGACG
                  Chromosome:
                  12:120982460
                  Gene:
                  HNF1A (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.4383/2195
                  HGVS:
                  NC_000012.11:g.121420263A>G, NC_000012.12:g.120982460A>G, NG_011731.2:g.8715A>G, NM_000545.5:c.326+3366A>G, NM_000545.6:c.326+3366A>G, NM_001306179.1:c.326+3366A>G, XM_005253931.1:c.326+3366A>G, XM_005253931.2:c.326+3366A>G, XM_005253932.1:c.-26+3366A>G, XM_011538713.1:c.326+3366A>G
                  9.

                  rs7979473 [Homo sapiens]
                    GACTCAGGAAAACAGTAGCCACGGC[A/C/G]GGAGGGGGGGGGGACAGAGGATCTG
                    Chromosome:
                    12:120982457
                    Gene:
                    HNF1A (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.4381/2194
                    HGVS:
                    NC_000012.11:g.121420260A>G, NC_000012.12:g.120982457A>G, NG_011731.2:g.8712A>G, NM_000545.5:c.326+3363A>G, NM_000545.6:c.326+3363A>G, NM_001306179.1:c.326+3363A>G, XM_005253931.1:c.326+3363A>G, XM_005253931.2:c.326+3363A>G, XM_005253932.1:c.-26+3363A>G, XM_011538713.1:c.326+3363A>G
                    10.

                    rs7953249 [Homo sapiens]
                      CTTGGCCATCGGTGGGATATCTGTC[A/G]ACGGTAAATGGCTTTAGCAAGACCC
                      Chromosome:
                      12:120965921
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.4311/2159
                      HGVS:
                      NC_000012.11:g.121403724G>A, NC_000012.12:g.120965921G>A
                      11.

                      rs7730843 [Homo sapiens]
                        gctttaacatagcaaaCAGttacaa[A/G]tataaataactatttaatcctcacc
                        Chromosome:
                        5:36542210
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.2678/1341
                        HGVS:
                        NC_000005.10:g.36542210G>A, NC_000005.9:g.36542312G>A
                        12.

                        rs7539471 [Homo sapiens]
                          tgctgctgccaggggatagagcagg[A/G]gcattgttggtgattcgagaaggtt
                          Chromosome:
                          1:65719720
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.1945/974
                          HGVS:
                          NC_000001.10:g.66185403G>A, NC_000001.11:g.65719720G>A
                          13.

                          rs7310409 [Homo sapiens]
                            AGAGACATGACTCACAGGTGGCATC[A/G]GGTCCCTTTGAGTCTCTCTGGTGGG
                            Chromosome:
                            12:120987058
                            Gene:
                            HNF1A (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.4062/2034
                            HGVS:
                            NC_000012.11:g.121424861A>G, NC_000012.12:g.120987058A>G, NG_011731.2:g.13313A>G, NM_000545.5:c.327-1775A>G, NM_000545.6:c.327-1775A>G, NM_001306179.1:c.327-1775A>G, XM_005253931.1:c.327-1775A>G, XM_005253931.2:c.327-1775A>G, XM_005253932.1:c.-25-1775A>G, XM_011538713.1:c.327-1775A>G
                            14.

                            rs7305618 [Homo sapiens]
                              TCTGGCCTCTTCTGCGATCGCTTCT[C/T]CTGTCTCCACCCTGCTCTGTGTGTG
                              Chromosome:
                              12:120965129
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              T=0.3558/1782
                              HGVS:
                              NC_000012.11:g.121402932C>T, NC_000012.12:g.120965129C>T
                              16.

                              rs4655537 [Homo sapiens]
                                AATCCTGGATCTATGTAATGGATGT[A/G]TATTGATTGGATATCACTTTTTCAC
                                Chromosome:
                                1:65593118
                                Gene:
                                LEPR (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                A=0.3063/1534
                                HGVS:
                                NC_000001.10:g.66058801A>G, NC_000001.11:g.65593118A>G, NG_015831.2:g.177554A>G, NM_001003679.3:c.703+253A>G, NM_001003680.3:c.703+253A>G, NM_001198687.1:c.703+253A>G, NM_001198688.1:c.703+253A>G, NM_001198689.1:c.703+253A>G, NM_002303.5:c.703+253A>G, XM_005270950.1:c.703+253A>G, XM_005270951.1:c.703+253A>G, XM_005270952.1:c.703+253A>G
                                17.

                                rs4291477 [Homo sapiens]
                                  CATCTGAGCAGCAGAAAAAGAATGA[A/G]GACAACGGTCCCACTTGGGACAGAA
                                  Chromosome:
                                  1:65725392
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  A=0.4569/2288
                                  HGVS:
                                  NC_000001.10:g.66191075G>A, NC_000001.11:g.65725392G>A
                                  18.

                                  rs4129267 [Homo sapiens]
                                    CTCAGCTTGGAGTGGGGTCAATTCT[C/T]AAAGGAAATGACATCACCTCATCTG
                                    Chromosome:
                                    1:154453788
                                    Gene:
                                    IL6R (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    T=0.2937/1471
                                    HGVS:
                                    NC_000001.10:g.154426264C>T, NC_000001.11:g.154453788C>T, NG_012087.1:g.53596C>T, NM_000565.3:c.1067-700C>T, NM_181359.2:c.1066+3808C>T, XM_005245138.1:c.1004-700C>T, XM_005245139.1:c.924+3808C>T, XM_005245140.1:c.925-700C>T, XM_006711298.1:c.1115-700C>T, XM_006711299.2:c.1114+3808C>T
                                    19.

                                    rs2889195 [Homo sapiens]
                                      CATTTTCTTAGTGCCTACATGATAC[C/T]ATCTCCTCTCTATAACTCTGAGCTT
                                      Chromosome:
                                      1:65691047
                                      Validated:
                                      by 1000G,by cluster,by frequency,by hapmap,by submitter
                                      Global MAF:
                                      C=0.4900/2454
                                      HGVS:
                                      NC_000001.10:g.66156730C>T, NC_000001.11:g.65691047C>T
                                      20.

                                      rs2794520 [Homo sapiens]
                                        ATCTGTGTGTATGAAGGGCATAGGA[C/T]AGACGGGTCCACACTGAATGAGGCC
                                        Chromosome:
                                        1:159709026
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                        Global MAF:
                                        T=0.3421/1713
                                        HGVS:
                                        NC_000001.10:g.159678816C>T, NC_000001.11:g.159709026C>T

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Write to the Help Desk