Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 3

1.

rs10505477 [Homo sapiens]
    TTGTCTATCAAACAGGAAGCCTTAA[C/T]TGGAGATGAAGATTTAGAAAAGGGG
    Chromosome:
    8:127395198
    Gene:
    CASC8 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4231/2119
    HGVS:
    NC_000008.10:g.128407443A>G, NC_000008.11:g.127395198A>G, NR_117100.1:n.1176+25631T>C
    2.

    rs6983267 [Homo sapiens]
      GTCCTTTGAGCTCAGCAGATGAAAG[G/T]CACTGAGAAAAGTACAAAGAATTTT
      Chromosome:
      8:127401060
      Gene:
      CASC8 (GeneView) CCAT2 (GeneView)
      Functional Consequence:
      intron variant,nc transcript variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3902/1954
      HGVS:
      NC_000008.10:g.128413305G>T, NC_000008.11:g.127401060G>T, NR_109834.1:n.662G>T, NR_117100.1:n.1176+19769C>A
      3.

      rs719725 [Homo sapiens]
        GATTATGTTCAATGAGATATATATA[A/C]GATAGCATCAATAAACATTAGTTCT
        Chromosome:
        9:6365683
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.3057/1531
        HGVS:
        NC_000009.11:g.6365683A>C, NC_000009.12:g.6365683A>C

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Write to the Help Desk