Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 2

1.

rs998075 [Homo sapiens]
    GTGTGTGTCTTTCATTGTTATAGGG[C/T]GTGCCGCCTCTGTAGTTCAGTTGGA
    Chromosome:
    6:160047246
    Gene:
    IGF2R (GeneView)
    Functional Consequence:
    nc transcript variant,synonymous codon
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4225/2116
    HGVS:
    NC_000006.11:g.160468278A>G, NC_000006.12:g.160047246A>G, NG_011785.3:g.83148A>G, NM_000876.3:c.2139A>G, NP_000867.2:p.Thr713, XR_942419.1:n.2154A>G
    2.

    rs998074 [Homo sapiens]
      AGTATCCTCAGGGAGCGCGATGAGG[A/G]ACAAACATTCCTACCTGATATTCAG
      Chromosome:
      6:160047351
      Gene:
      IGF2R (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.4269/2138
      HGVS:
      NC_000006.11:g.160468383T>C, NC_000006.12:g.160047351T>C, NG_011785.3:g.83253T>C, NM_000876.3:c.2229+15T>C, XR_942419.1:n.2244+15T>C

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Write to the Help Desk