Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 2

1.

rs3863145 [Homo sapiens]
    GACGTTAGAGATAACACATCCACTA[C/T]GCTCCCATGCAGGTGTGCTGGGTGT
    Chromosome:
    5:1392596
    Gene:
    SLC6A3 (GeneView)
    Functional Consequence:
    downstream variant 500B
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.1683/843
    HGVS:
    NC_000005.10:g.1392596G>A, NC_000005.9:g.1392711G>A, NG_015885.1:g.57833C>T, NM_001044.4:c.*2139C>T, NT_187547.1:g.121413C>T
    2.

    rs27072 [Homo sapiens]
      AGTGCCCCTGGGGCAGCCTCAGAGC[C/T]GGGAGCAGGGAGCAGGGAGGGAGGG
      Chromosome:
      5:1394407
      Gene:
      SLC6A3 (GeneView)
      Functional Consequence:
      utr variant 3 prime
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.2051/1027
      HGVS:
      NC_000005.10:g.1394407C>T, NC_000005.9:g.1394522C>T, NG_015885.1:g.56022G>A, NM_001044.4:c.*328G>A, NT_187547.1:g.119602G>A

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Write to the Help Desk