Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 16

1.

rs10915884 [Homo sapiens]
    CCAAGAAGGGTCTAAAGAGACATGA[C/T]AGCTCAGTGGTGTGTGAGTCCTGGA
    Chromosome:
    1:225836174
    Gene:
    EPHX1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1849/926
    HGVS:
    NC_000001.10:g.226023875C>T, NC_000001.11:g.225836174C>T, NG_009776.1:g.31079C>T, NM_000120.3:c.365-2480C>T, NM_001136018.3:c.365-2480C>T, NM_001291163.1:c.365-2480C>T, XM_005273085.1:c.365-2480C>T
    2.

    rs2854450 [Homo sapiens]
      GTCACACCAGGCTAATCAAGAACAC[C/T]TTTCTTTGGTGCATTAACCACCTGC
      Chromosome:
      1:225824876
      Gene:
      EPHX1 (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      T=0.2312/1158
      HGVS:
      NC_000001.10:g.226012577T>C, NC_000001.11:g.225824876T>C, NG_009776.1:g.19781T>C, NM_000120.3:c.-674T>C, NM_001136018.3:c.-5-3849T>C, NM_001291163.1:c.-5-3849T>C, XM_005273085.1:c.-5-3849T>C
      3.

      rs2842958 [Homo sapiens]
        CCAGCTACTTGGGTGGCTGAGACAC[A/G]AGAATTGCATGAACCTGAAAGGCGG
        Chromosome:
        6:159687393
        Gene:
        SOD2 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency
        Global MAF:
        A=0.2646/1325
        HGVS:
        NC_000006.11:g.160108425A>G, NC_000006.12:g.159687393A>G, NG_008729.1:g.10929T>C, NM_000636.2:c.343+733T>C, NM_001024465.1:c.343+733T>C, NM_001024466.1:c.227-2360T>C
        4.

        rs2740171 [Homo sapiens]
          gagccaccacaccaggccCAAAAAT[A/C]CTCCACTTTAAAGAAAATATCATTT
          Chromosome:
          1:225837827
          Gene:
          EPHX1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.2280/1142
          HGVS:
          NC_000001.10:g.226025528A>C, NC_000001.11:g.225837827A>C, NG_009776.1:g.32732A>C, NM_000120.3:c.365-827A>C, NM_001136018.3:c.365-827A>C, NM_001291163.1:c.365-827A>C, XM_005273085.1:c.365-827A>C
          5.

          rs2740168 [Homo sapiens]
            TAAAATTCTAGGAATTACTTAAAGT[A/G]TATGAAAGACATGTTGGTCAGTCAG
            Chromosome:
            1:225833287
            Gene:
            EPHX1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.4760/2384
            HGVS:
            NC_000001.10:g.226020988G>A, NC_000001.11:g.225833287G>A, NG_009776.1:g.28192G>A, NM_000120.3:c.364+1328G>A, NM_001136018.3:c.364+1328G>A, NM_001291163.1:c.364+1328G>A, XM_005273085.1:c.364+1328G>A
            6.

            rs2260863 [Homo sapiens]
              AGAGATTCAGAACCCAATTATAGGT[C/G]ACTGAGATGTACTTATACGTTGTAA
              Chromosome:
              1:225832073
              Gene:
              EPHX1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.2564/1284
              HGVS:
              NC_000001.10:g.226019774G>C, NC_000001.11:g.225832073G>C, NG_009776.1:g.26978G>C, NM_000120.3:c.364+114G>C, NM_001136018.3:c.364+114G>C, NM_001291163.1:c.364+114G>C, XM_005273085.1:c.364+114G>C
              7.

              rs2234922 [Homo sapiens]
                AAGCCCCCCCAGCTGCCCGCAGGCC[A/G/T]TACCCCGAAGCCCTTGCTGATGGTG
                Chromosome:
                1:225838705
                Gene:
                EPHX1 (GeneView)
                Functional Consequence:
                missense
                Allele Origin:
                G(germline)/A(germline)
                Clinical significance:
                drug-response
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.2155/1079
                HGVS:
                NC_000001.10:g.226026406A>G, NC_000001.11:g.225838705A>G, NG_009776.1:g.33610A>G, NM_000120.3:c.416A>G, NM_001136018.3:c.416A>G, NM_001291163.1:c.416A>G, NP_000111.1:p.His139Arg, NP_001129490.1:p.His139Arg, NP_001278092.1:p.His139Arg, XM_005273085.1:c.416A>G, XP_005273142.1:p.His139Arg
                8.

                rs1571858 [Homo sapiens]
                  GGAAGAGCCTAACTTCTATACCTTG[A/G]AGGCACTGTCTACAAAAAAATGGAG
                  Chromosome:
                  1:109737292
                  Gene:
                  GSTM3 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  T=0.3694/1850
                  HGVS:
                  NC_000001.10:g.110279914C>T, NC_000001.11:g.109737292C>T, NM_000849.4:c.580-123G>A, NR_024537.1:n.814-123G>A, XM_011541296.1:c.799-123G>A
                  9.

                  rs1537234 [Homo sapiens]
                    GCATCTGTTGGACTGGGTTGGGGTC[A/G/T]TTATAAGATTTGGTGTATTTTCCTT
                    Chromosome:
                    1:109737199
                    Gene:
                    GSTM3 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    A=0.4868/2438
                    HGVS:
                    NC_000001.10:g.110279821C>A, NC_000001.11:g.109737199C>A, NM_000849.4:c.580-30G>T, NR_024537.1:n.814-30G>T, XM_011541296.1:c.799-30G>T
                    10.

                    rs1109138 [Homo sapiens]
                      AATTTTTTTTAATTAGCTGTGCGCA[A/G]TTGCTCATGCATAGTCCCAGCTACC
                      Chromosome:
                      1:109735327
                      Gene:
                      GSTM3 (GeneView)
                      Functional Consequence:
                      nc transcript variant,utr variant 3 prime
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.2402/1203
                      HGVS:
                      NC_000001.10:g.110277949T>C, NC_000001.11:g.109735327T>C, NM_000849.4:c.*1744A>G, NR_024537.1:n.2656A>G
                      11.

                      rs1051741 [Homo sapiens]
                        TCTCCCTGGACGACCTGCTGACCAA[C/T]GTCATGCTCTACTGGACAACAGGCA
                        Chromosome:
                        1:225844528
                        Gene:
                        EPHX1 (GeneView) TMEM63A (GeneView)
                        Functional Consequence:
                        intron variant,synonymous codon
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.1264/633
                        HGVS:
                        NC_000001.10:g.226032229C>T, NC_000001.11:g.225844528C>T, NG_009776.1:g.39433C>T, NM_000120.3:c.1071C>T, NM_001136018.3:c.1071C>T, NM_001291163.1:c.1071C>T, NP_000111.1:p.Asn357, NP_001129490.1:p.Asn357, NP_001278092.1:p.Asn357, XM_005273085.1:c.1071C>T, XP_005273142.1:p.Asn357, XR_949163.1:n.2830+2310G>A
                        12.

                        rs1051740 [Homo sapiens]
                          GAAGCAGGTGGAGATTCTCAACAGA[C/T]ACCCTCACTTCAAGACTAAGATTGA
                          Chromosome:
                          1:225831932
                          Gene:
                          EPHX1 (GeneView)
                          Functional Consequence:
                          missense
                          Allele Origin:
                          T(germline)/C(germline)
                          Clinical significance:
                          drug-response
                          Validated:
                          no info
                          Global MAF:
                          C=0.3133/1569
                          HGVS:
                          NC_000001.10:g.226019633T>C, NC_000001.11:g.225831932T>C, NG_009776.1:g.26837T>C, NM_000120.3:c.337T>C, NM_001136018.3:c.337T>C, NM_001291163.1:c.337T>C, NP_000111.1:p.Tyr113His, NP_001129490.1:p.Tyr113His, NP_001278092.1:p.Tyr113His, XM_005273085.1:c.337T>C, XP_005273142.1:p.Tyr113His
                          13.

                          rs762803 [Homo sapiens]
                            GGCCGCACCCTTGGTGAGTCTTGAA[A/C]CTCCAAGTCCAGGGCAGGCATGGGC
                            Chromosome:
                            11:67584785
                            Gene:
                            GSTP1 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.3119/1562
                            HGVS:
                            NC_000011.10:g.67584785C>A, NC_000011.9:g.67352256C>A, NG_012075.1:g.6191C>A, NM_000852.3:c.232+13C>A, XM_005273958.1:c.232+13C>A
                            14.

                            rs173278 [Homo sapiens]
                              GGAAAATGGCCAAAGCTTAGACCAA[A/G]AAATAGGGTTGGGGAGTTGGGGCCA
                              Chromosome:
                              5:149346670
                              Gene:
                              GRPEL2 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              no info
                              HGVS:
                              NC_000005.10:g.149346670C>T, NC_000005.9:g.148726233C>T, NM_152407.3:c.77+1054C>T, XM_005268374.1:c.77+1054C>T
                              15.

                              rs4880 [Homo sapiens]
                                AGCACCAGCAGGCAGCTGGCTCCGG[C/T]TTTGGGGTATCTGGGCTCCAGGCAG
                                Chromosome:
                                6:159692840
                                Gene:
                                SOD2 (GeneView)
                                Functional Consequence:
                                missense
                                Allele Origin:
                                T(germline)/C(germline)
                                Clinical significance:
                                drug-response
                                Validated:
                                no info
                                Global MAF:
                                G=0.4107/2057
                                HGVS:
                                NC_000006.11:g.160113872A>G, NC_000006.12:g.159692840A>G, NG_008729.1:g.5482T>C, NM_000636.2:c.47T>C, NM_001024465.1:c.47T>C, NM_001024466.1:c.47T>C, NP_000627.2:p.Val16Ala, NP_001019636.1:p.Val16Ala, NP_001019637.1:p.Val16Ala
                                16.

                                rs1695 [Homo sapiens]
                                  CGTGGAGGACCTCCGCTGCAAATAC[A/G]TCTCCCTCATCTACACCAACTATGT
                                  Chromosome:
                                  11:67585218
                                  Gene:
                                  GSTP1 (GeneView)
                                  Functional Consequence:
                                  missense
                                  Clinical significance:
                                  drug-response
                                  Validated:
                                  no info
                                  Global MAF:
                                  G=0.3526/1766
                                  HGVS:
                                  NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center