Display Settings:

Format

Send to:

Choose Destination
1.

rs2717162 [Homo sapiens]
    AGGTTTGAGATGAGCCTCCCACCGT[C/T]AGGATGGGAATGGAGGGTCGGCCTT
    Chromosome:
    18:77256371
    Gene:
    GALR1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.3782/1894
    HGVS:
    NC_000018.10:g.77256371T>C, NC_000018.9:g.74968327T>C, NG_009223.1:g.11320T>C, NM_001480.3:c.732+148T>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk