Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 11

1.

rs17878544 [Homo sapiens]
    TAATTCCCTTTTGGCCATTTAACCT[A/G]TCATATTCACAAGTTCCAGGGATTC
    Chromosome:
    16:31096606
    Gene:
    VKORC1 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    C=0.1208/605
    HGVS:
    NC_000016.10:g.31096606T>C, NC_000016.9:g.31107927T>C, NG_011564.1:g.3350A>G, NM_001311311.1:c.-1877A>G, NM_024006.5:c.-1877A>G, NM_206824.2:c.-1877A>G, XM_005255568.1:c.-1877A>G, XM_011545943.1:c.-1877A>G, XM_011545944.1:c.-1490A>G, XM_011545945.1:c.-1490A>G, XR_243303.1:n.-1228A>G, XR_950848.1:n.-269A>G
    2.

    rs17708472 [Homo sapiens]
      AAGTAATTCTTAAAATGGCAAGGCT[A/G]GTATAACGGTTCACTCGGTTTTGCA
      Chromosome:
      16:31094032
      Gene:
      VKORC1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0937/469
      HGVS:
      NC_000016.10:g.31094032G>A, NC_000016.9:g.31105353G>A, NG_011564.1:g.5924C>T, NM_001311311.1:c.173+525C>T, NM_024006.5:c.173+525C>T, NM_206824.2:c.173+525C>T, XM_005255568.1:c.173+525C>T, XM_011545943.1:c.173+525C>T, XM_011545944.1:c.173+525C>T, XM_011545945.1:c.173+525C>T, XR_243303.1:n.822+525C>T, XR_950848.1:n.961+525C>T
      3.

      rs10187424 [Homo sapiens]
        gaagaccccaggagtttctaggcca[C/T]ccaCCGAGAACTATTGTCCTAAAGG
        Chromosome:
        2:85567174
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.4677/2342
        HGVS:
        NC_000002.11:g.85794297T>C, NC_000002.12:g.85567174T>C
        4.

        rs8050894 [Homo sapiens]
          CCACATCCCCACCCGCAGGACGCTC[C/G/T]GTGATGAGCAGCTAGCTGGCTGTCA
          Chromosome:
          16:31093188
          Gene:
          VKORC1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4163/2085
          HGVS:
          NC_000016.10:g.31093188C>G, NC_000016.9:g.31104509C>G, NG_011564.1:g.6768G>C, NM_001311311.1:c.283+124G>C, NM_024006.5:c.283+124G>C, NM_206824.2:c.173+1369G>C, XM_005255568.1:c.283+124G>C, XM_011545943.1:c.283+124G>C, XM_011545944.1:c.283+124G>C, XM_011545945.1:c.173+1369G>C, XR_243303.1:n.832+124G>C, XR_950848.1:n.1071+124G>C
          5.

          rs7568458 [Homo sapiens]
            CTCCACCTCAAATCAAAGAAATCAC[A/T]GCACCAACAGCTCAGAGCTTCCGCC
            Chromosome:
            2:85561052
            Gene:
            GGCX (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.4868/2438
            HGVS:
            NC_000002.11:g.85788175T>A, NC_000002.12:g.85561052T>A, NG_011811.2:g.5483A>T, NM_000821.6:c.44-67A>T, NM_001142269.3:c.43+334A>T, NM_001311312.1:c.44-67A>T, XM_005264259.1:c.44-67A>T, XM_005264259.3:c.44-67A>T, XM_011532764.1:c.-615-67A>T, XM_011532765.1:c.-445+334A>T, XR_939677.1:n.109-67A>T
            6.

            rs2884737 [Homo sapiens]
              GCAGCCATCGCCAACACCCCCCTTC[A/C]CCTGCGCGCCGTCCTTGAGACCATC
              Chromosome:
              16:31094233
              Gene:
              VKORC1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.0915/458
              HGVS:
              NC_000016.10:g.31094233A>C, NC_000016.9:g.31105554A>C, NG_011564.1:g.5723T>G, NM_001311311.1:c.173+324T>G, NM_024006.5:c.173+324T>G, NM_206824.2:c.173+324T>G, XM_005255568.1:c.173+324T>G, XM_011545943.1:c.173+324T>G, XM_011545944.1:c.173+324T>G, XM_011545945.1:c.173+324T>G, XR_243303.1:n.822+324T>G, XR_950848.1:n.961+324T>G
              7.

              rs2028898 [Homo sapiens]
                GGTGAAACAGGAGTTTGAACTTGGT[A/C/T]GGCTTTTTCCTGTTTTTCAGCTTCC
                Chromosome:
                2:85550147
                Gene:
                GGCX (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                A=0.2861/1433
                HGVS:
                NC_000002.11:g.85777270G>A, NC_000002.12:g.85550147G>A, NG_011811.2:g.16388C>T, NM_000821.6:c.2085-21C>T, NM_001142269.3:c.1914-21C>T, XM_005264259.1:c.2079-21C>T, XM_005264259.3:c.2079-21C>T, XM_011532764.1:c.1263-21C>T, XM_011532765.1:c.1263-21C>T
                8.

                rs1800801 [Homo sapiens]
                  CCTCACAGCCTTCCACTAACATCCC[A/G]TAGGAGCCTCTCTCCCTACTGCTGC
                  Chromosome:
                  12:14885854
                  Gene:
                  MGP (GeneView)
                  Functional Consequence:
                  utr variant 5 prime
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  T=0.2622/1313
                  HGVS:
                  NC_000012.11:g.15038788C>T, NC_000012.12:g.14885854C>T, NG_023331.1:g.5066G>A, NM_000900.3:c.-63G>A, NM_001190839.1:c.-63G>A
                  9.

                  rs699664 [Homo sapiens]
                    CGGAAGCTGGTGTCCTACTGCCCCC[A/G]AAGGTTGCAACAACTGTTGCCCCTC
                    Chromosome:
                    2:85553413
                    Gene:
                    GGCX (GeneView)
                    Functional Consequence:
                    missense,nc transcript variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.3778/1892
                    HGVS:
                    NC_000002.11:g.85780536C>T, NC_000002.12:g.85553413C>T, NG_011811.2:g.13122G>A, NM_000821.6:c.974G>A, NM_001142269.3:c.803G>A, NP_000812.2:p.Arg325Gln, NP_001135741.1:p.Arg268Gln, XM_005264259.1:c.974G>A, XM_005264259.3:c.974G>A, XM_011532764.1:c.152G>A, XM_011532765.1:c.152G>A, XP_005264316.1:p.Arg325Gln, XP_011531066.1:p.Arg51Gln, XP_011531067.1:p.Arg51Gln, XR_939677.1:n.1039G>A
                    10.

                    rs7294 [Homo sapiens]
                      ATTACCCCCTCCTCCTGCCATACCC[A/G]CACATGACAATGGACCAAATGTGCC
                      Chromosome:
                      16:31091000
                      Gene:
                      PRSS53 (GeneView) VKORC1 (GeneView)
                      Functional Consequence:
                      nc transcript variant,upstream variant 2KB,utr variant 3 prime
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      T=0.4197/2102
                      HGVS:
                      NC_000016.10:g.31091000C>T, NC_000016.9:g.31102321C>T, NG_011564.1:g.8956G>A, NM_001311311.1:c.*134G>A, NM_024006.5:c.*134G>A, NM_206824.2:c.*237G>A, XM_005255568.1:c.*134G>A, XM_011545816.1:c.-2191G>A, XM_011545817.1:c.-2191G>A, XM_011545818.1:c.-2191G>A, XM_011545819.1:c.-2191G>A, XM_011545820.1:c.-2191G>A, XM_011545943.1:c.*134G>A, XM_011545944.1:c.*134G>A, XM_011545945.1:c.*237G>A, XR_243303.1:n.1175G>A, XR_950848.1:n.1414G>A
                      11.

                      rs4236 [Homo sapiens]
                        TCGCTACTTCAGGAAGCGCCGAGGG[A/G]CCAAATGAGACTGAGGGAAGAAAAA
                        Chromosome:
                        12:14882147
                        Gene:
                        MGP (GeneView)
                        Functional Consequence:
                        missense
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.3854/1930
                        HGVS:
                        NC_000012.11:g.15035081T>C, NC_000012.12:g.14882147T>C, NG_023331.1:g.8773A>G, NM_000900.3:c.304A>G, NM_001190839.1:c.379A>G, NP_000891.2:p.Thr102Ala, NP_001177768.1:p.Thr127Ala

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Write to the Help Desk