Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 3

1.

rs9296158 [Homo sapiens]
    CCTGGTAATATCACTCTCAATATCA[A/G]TATAGTCCAGAAACCAGCTTCAAAT
    Chromosome:
    6:35599305
    Gene:
    FKBP5 (GeneView) LOC105375033 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.3594/1800
    HGVS:
    NC_000006.11:g.35567082A>G, NC_000006.12:g.35599305A>G, NG_012645.2:g.134279T>C, NM_001145775.2:c.509-1901T>C, NM_001145776.1:c.509-1901T>C, NM_001145777.1:c.509-1901T>C, NM_004117.3:c.509-1901T>C, XR_926744.1:n.-1083A>G
    2.

    rs3800373 [Homo sapiens]
      TAATTTTTAAAAACAAAATCTGTAG[G/T]GTTGACAAATAAATAGTTGCTCTTC
      Chromosome:
      6:35574699
      Gene:
      FKBP5 (GeneView) LOC101929309 (GeneView)
      Functional Consequence:
      intron variant,utr variant 3 prime
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.3253/1629
      HGVS:
      NC_000006.11:g.35542476C>A, NC_000006.12:g.35574699C>A, NG_012645.2:g.158885G>T, NM_001145775.2:c.*1136G>T, NM_001145776.1:c.*1136G>T, NM_004117.3:c.*1136G>T, XR_242006.1:n.180-18331C>A, XR_242006.2:n.433-18331C>A, XR_242008.1:n.201-18331C>A
      3.

      rs1360780 [Homo sapiens]
        GAAGGCTTTCACATAAGCAAAGTTA[C/T]ACAAAACAAAAATTCTTACTTGCTA
        Chromosome:
        6:35639794
        Gene:
        FKBP5 (GeneView) LOC105375032 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3273/1639
        HGVS:
        NC_000006.11:g.35607571T>C, NC_000006.12:g.35639794T>C, NG_012645.2:g.93790A>G, NM_001145775.2:c.106-2636A>G, NM_001145776.1:c.106-2636A>G, NM_001145777.1:c.106-2636A>G, NM_004117.3:c.106-2636A>G, XR_926743.1:n.287+5974T>C

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Write to the Help Desk