Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 15

1.

rs51612205 [Mus musculus]
    CTTCGGGCAGAGAAGGCTGGAGCTG[G/T]AAGGATAGAAAGGAAGTCGGGTGTG
    Chromosome:
    5:107289776
    Gene:
    Tgfbr3 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by frequency
    2.

    rs49224805 [Mus musculus]
      CATCCACGGAAGTGTAGCTTACCAC[A/G]TACCTGTCGATGTCAGCCTCCACTG
      Chromosome:
      1:160126501
      Gene:
      Tnn (GeneView)
      Functional Consequence:
      synonymous codon
      Validated:
      by frequency
      3.

      rs48672482 [Mus musculus]
        TTTGCAGAAATGCGATCACGGGAGC[A/G]CAAACGCTAACGGGGTTCAGGAAAC
        Chromosome:
        12:12940906
        Gene:
        Mycn (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by frequency
        4.

        rs46709434 [Mus musculus]
          TGCTGGAAATGTCTTTCTTCACGTT[G/T]CGCAGGGTGACTATGTACTTGGTTC
          Chromosome:
          1:160145035
          Gene:
          Tnn (GeneView)
          Functional Consequence:
          synonymous codon
          Validated:
          by frequency
          5.

          rs33408603 [Mus musculus]
            CAGAGAGGTACTGACTGCTCCAAGG[A/G]AGAGGAGGATGGGAGAGGCGCTCCG
            Chromosome:
            2:58516201
            Gene:
            Acvr1 (GeneView)
            Functional Consequence:
            intron variant,utr variant 5 prime
            Validated:
            by frequency
            6.

            rs32922832 [Mus musculus]
              TGTCAAGTTCAAATTGGAGGACAGC[C/T]TAGCTTCAAATGAATGCAGTTATCC
              Chromosome:
              1:37444484
              Gene:
              Mgat4a (GeneView)
              Functional Consequence:
              utr variant 3 prime
              Validated:
              by frequency
              7.

              rs32034023 [Mus musculus]
                CCCCTTCTGAGCCCACACTTGGACC[A/G]TGTACTCCACACCCGGTCTCAGGCC
                Chromosome:
                1:160114556
                Gene:
                Tnn (GeneView)
                Functional Consequence:
                missense
                Validated:
                by frequency
                8.

                rs31343079 [Mus musculus]
                  ATTCTCGCGAGCGATCGAATGCTCA[C/G]GAGGCGTCCAGCCACTTCCTTCCGC
                  Chromosome:
                  1:160212937
                  Gene:
                  Cacybp (GeneView)
                  Functional Consequence:
                  upstream variant 2KB
                  Validated:
                  by frequency
                  9.

                  rs31320021 [Mus musculus]
                    TGGCTAAAATTCTGAATCTTTTACC[A/G]TGTAAGAATCTCAGTTCATCATTTC
                    Chromosome:
                    1:159235302
                    Gene:
                    Rfwd2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by frequency
                    10.

                    rs27956803 [Mus musculus]
                      AGCCCTTGACGTCTCTATGGCTTTT[C/T]GGAGCTACATTTAGAGGAGAACCAA
                      Chromosome:
                      2:59009181
                      Validated:
                      by frequency
                      11.

                      rs27914711 [Mus musculus]
                        GTGTATATACTTCCACTGTGTCAAC[A/G]TCTTCAGTGGAATGGCTCTCTTGGC
                        Chromosome:
                        2:52461645
                        Gene:
                        Cacnb4 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by frequency
                        12.

                        rs27124906 [Mus musculus]
                          GTGCATCTGCACCTAACTCAAGTAG[G/T]CTCTTGTATGTCTAGCCACAAGTGT
                          Chromosome:
                          2:43748338
                          Gene:
                          Arhgap15 (GeneView) LOC105244137 (GeneView)
                          Functional Consequence:
                          intron variant,upstream variant 2KB
                          Validated:
                          by frequency
                          13.

                          rs6406107 [Mus musculus]
                            GAGAGGANGATGGGAGAGGCGCTCC[A/G]GGAGGAGTCTTCCGGAAGCTGTACC
                            Chromosome:
                            2:58516226
                            Gene:
                            Acvr1 (GeneView)
                            Functional Consequence:
                            intron variant,utr variant 5 prime
                            Validated:
                            by frequency
                            14.

                            rs6406068 [Mus musculus]
                              GTACTGACTGCTCCAAGGGAGAGGA[C/G]GATGGGAGAGGCGCTCCNGGAGGAG
                              Chromosome:
                              2:58516208
                              Gene:
                              Acvr1 (GeneView)
                              Functional Consequence:
                              intron variant,utr variant 5 prime
                              Validated:
                              by frequency
                              15.

                              rs4228631 [Mus musculus]
                                GCGCAACAGGCTTGCTTCTGCTTCG[G/T]CCATGGCGCACAGGAATGGCCGCCG
                                Chromosome:
                                11:26387219
                                Gene:
                                Fancl (GeneView)
                                Functional Consequence:
                                missense,nc transcript variant
                                Validated:
                                by frequency

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Write to the Help Desk