Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 5

1.

rs12949488 [Homo sapiens]
    GTTTCTCTTAGGTCTCCCTGAAGCT[C/T]ATTTGCAACTTGGATGCACCTCAGG
    Chromosome:
    17:82077020
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.2618/1311
    HGVS:
    NC_000017.10:g.80034896C>T, NC_000017.11:g.82077020C>T
    2.

    rs8066956 [Homo sapiens]
      ggcggtcccgggacagcccctgcac[C/T]ccgccactgtctgccagctcccccc
      Chromosome:
      17:82076567
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1633/818
      HGVS:
      NC_000017.10:g.80034443C>T, NC_000017.11:g.82076567C>T
      3.

      rs6502051 [Homo sapiens]
        CAAGTAGGACAGATAAACAACGCTA[A/C]GGCCAAGCAGACGCCCCAGGGAGGA
        Chromosome:
        17:82101456
        Gene:
        CCDC57 (GeneView)
        Functional Consequence:
        downstream variant 500B
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.4395/2201
        HGVS:
        NC_000017.10:g.80059332A>C, NC_000017.11:g.82101456A>C, NM_198082.2:c.*226T>G, XM_005256344.1:c.*226T>G
        4.

        rs4246444 [Homo sapiens]
          GAATGGCACCCGTGACGAAGGGCGG[G/T]ATGCCTGCCGGGACACGGTCCAGAC
          Chromosome:
          17:82081076
          Gene:
          FASN (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency
          Global MAF:
          T=0.3363/1684
          HGVS:
          NC_000017.10:g.80038952T>G, NC_000017.11:g.82081076T>G, NM_004104.4:c.6595+88A>C, XM_011523538.1:c.6595+88A>C
          5.

          rs1127678 [Homo sapiens]
            GCATGGTGCCTGTGCTTTCACCTAC[A/G]TGTTGTGGGGGGGTGTGGGCACAGC
            Chromosome:
            17:82101611
            Gene:
            CCDC57 (GeneView)
            Functional Consequence:
            utr variant 3 prime
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.1767/885
            HGVS:
            NC_000017.10:g.80059487C>T, NC_000017.11:g.82101611C>T, NM_198082.2:c.*71G>A, XM_005256344.1:c.*71G>A

            Display Settings:

            Format
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Write to the Help Desk