Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 10

1.

rs35898099 [Homo sapiens]
    TTAAGAGCAATCAAAAAAAGTACCT[A/G]CTTATTTGGGGAGCAAAGAACAGAT
    Chromosome:
    6:136793620
    Gene:
    MAP3K5 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.1208/605
    HGVS:
    NC_000006.11:g.137114758G>A, NC_000006.12:g.136793620G>A, NG_011965.1:g.3899C>T, NM_005923.3:c.-1463C>T, XM_005266990.1:c.-1463C>T, XM_005266991.1:c.-1463C>T, XM_005266992.1:c.-1463C>T, XM_011535837.1:c.-1463C>T, XM_011535838.1:c.-1463C>T, XM_011535839.1:c.-1463C>T
    2.

    rs10484491 [Homo sapiens]
      CCACATGGGGCAAAGAAGAACCAAC[A/G]AGGACTTTCATGCAAAGGAGCATGT
      Chromosome:
      6:136706729
      Gene:
      MAP3K5 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.3596/1801
      HGVS:
      NC_000006.11:g.137027867A>G, NC_000006.12:g.136706729A>G, NG_011965.1:g.90790T>C, NM_005923.3:c.589-1596T>C, XM_005266990.1:c.589-1596T>C, XM_005266991.1:c.589-1596T>C, XM_005266992.1:c.589-1596T>C, XM_011535837.1:c.589-1596T>C, XM_011535838.1:c.589-1596T>C, XM_011535839.1:c.589-1596T>C
      3.

      rs7775356 [Homo sapiens]
        AAATTAGGCCTGTCATCTTTTTACA[A/T]CTTTAATGAAAGAGGCTTAGGCTTA
        Chromosome:
        6:136635502
        Gene:
        LOC101928461 (GeneView) MAP3K5 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3103/1554
        HGVS:
        NC_000006.11:g.136956640T>A, NC_000006.12:g.136635502T>A, NG_011965.1:g.162017A>T, NM_005923.3:c.2016+1823A>T, NR_125858.1:n.164-1429T>A, XM_005266990.1:c.1908+1823A>T, XM_005266991.1:c.2016+1823A>T, XM_011535837.1:c.1908+1823A>T, XM_011535838.1:c.2016+1823A>T, XM_011535839.1:c.2016+1823A>T, XR_245609.1:n.123-1429T>A
        5.

        rs4351280 [Homo sapiens]
          CTCTGTTCCTCTGAGGAACAACCTG[A/G]ATGTCAGTTGTCTGACTGCTTGAAT
          Chromosome:
          6:136556908
          Gene:
          MAP3K5 (GeneView)
          Functional Consequence:
          downstream variant 500B
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.2620/1312
          HGVS:
          NC_000006.11:g.136878046A>G, NC_000006.12:g.136556908A>G, NG_011965.1:g.240611T>C, NM_005923.3:c.*850T>C, XM_005266990.1:c.*850T>C, XM_005266991.1:c.*850T>C, XM_011535837.1:c.*850T>C, XM_011535838.1:c.*850T>C
          6.

          rs3765259 [Homo sapiens]
            CAGTATGAAACACCAAACAAGGAGA[C/T]ATAATAAGTTTCTTTTTTCTCTTTG
            Chromosome:
            6:136669145
            Gene:
            MAP3K5 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4503/2255
            HGVS:
            NC_000006.11:g.136990283T>C, NC_000006.12:g.136669145T>C, NG_011965.1:g.128374A>G, NM_005923.3:c.1366+138A>G, XM_005266990.1:c.1366+138A>G, XM_005266991.1:c.1366+138A>G, XM_005266992.1:c.1366+138A>G, XM_011535837.1:c.1366+138A>G, XM_011535838.1:c.1366+138A>G, XM_011535839.1:c.1366+138A>G
            7.

            rs3765258 [Homo sapiens]
              AGTCCCGACCTGCGTAGACTATCCC[A/C/G]TAAGTGCCTTTTCCTAAAACGACTC
              Chromosome:
              6:136622925
              Gene:
              MAP3K5 (GeneView)
              Functional Consequence:
              synonymous codon
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.1464/733
              HGVS:
              NC_000006.11:g.136944063A>G, NC_000006.12:g.136622925A>G, NG_011965.1:g.174594T>C, NM_005923.3:c.2073T>C, NP_005914.1:p.Tyr691, XM_005266990.1:c.1965T>C, XM_005266991.1:c.2073T>C, XM_011535837.1:c.1965T>C, XM_011535838.1:c.2073T>C, XM_011535839.1:c.2073T>C, XP_005267047.1:p.Tyr655, XP_005267048.1:p.Tyr691, XP_011534139.1:p.Tyr655, XP_011534140.1:p.Tyr691, XP_011534141.1:p.Tyr691
              8.

              rs2237269 [Homo sapiens]
                CTGCCTTTGCTTGATAATCCGTGAG[C/G]TAGGCCAAGGGTGCCCAAACTTCAA
                Chromosome:
                6:136645481
                Gene:
                LOC101928461 (GeneView) MAP3K5 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.2760/1382
                HGVS:
                NC_000006.11:g.136966619G>C, NC_000006.12:g.136645481G>C, NG_011965.1:g.152038C>G, NM_005923.3:c.1789-2912C>G, NR_125858.1:n.336-2291G>C, XM_005266990.1:c.1681-2912C>G, XM_005266991.1:c.1789-2912C>G, XM_005266992.1:c.1789-2912C>G, XM_011535837.1:c.1681-2912C>G, XM_011535838.1:c.1789-2912C>G, XM_011535839.1:c.1789-2912C>G, XR_245609.1:n.295-2291G>C
                9.
                10.

                rs1570056 [Homo sapiens]
                  AGCTCTACTTGGAACAGACGGCTGA[C/T]GGCCTAAGGAACCTGTAGCCACGTC
                  Chromosome:
                  6:136738789
                  Gene:
                  MAP3K5 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  C=0.4978/2493
                  HGVS:
                  NC_000006.11:g.137059927T>C, NC_000006.12:g.136738789T>C, NG_011965.1:g.58730A>G, NM_005923.3:c.449-18200A>G, XM_005266990.1:c.449-18200A>G, XM_005266991.1:c.449-18200A>G, XM_005266992.1:c.449-18200A>G, XM_011535837.1:c.449-18200A>G, XM_011535838.1:c.449-18200A>G, XM_011535839.1:c.449-18200A>G

                  Display Settings:

                  Format
                  Items per page
                  Sort by

                  Send to:

                  Choose Destination

                  Supplemental Content

                  Find related data

                  Recent activity

                  Your browsing activity is empty.

                  Activity recording is turned off.

                  Turn recording back on

                  See more...
                  Write to the Help Desk