Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 6

1.

rs16901937 [Homo sapiens]
    ATTTTTACCTGTATTTCCACCACCT[A/G]GAACTATGGCTAGTACATTACAGTA
    Chromosome:
    5:44709039
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4255/2131
    HGVS:
    NC_000005.10:g.44709039A>G, NC_000005.9:g.44709141A>G
    2.

    rs13156930 [Homo sapiens]
      GGCTGGTCCCTAGGCTGTCGTTTGC[C/G]AACCTCTGTGATAGACATAAAAGTG
      Chromosome:
      5:44697933
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4685/2346
      HGVS:
      NC_000005.10:g.44697933G>C, NC_000005.9:g.44698035G>C
      3.

      rs12515012 [Homo sapiens]
        GATCCCACCCCTGGATGCCACTGTA[A/G]GGTTGGAGCCCAGGAGTGCTCACTC
        Chromosome:
        5:44694433
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.4349/2178
        HGVS:
        NC_000005.10:g.44694433G>A, NC_000005.9:g.44694535G>A
        4.

        rs10941679 [Homo sapiens]
          AAATGTGGGATGCTTTTTATTGACT[A/G]TGGAAAGAACACAGCATAAAAAAAG
          Chromosome:
          5:44706396
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.3161/1583
          HGVS:
          NC_000005.10:g.44706396A>G, NC_000005.9:g.44706498A>G
          5.

          rs6451770 [Homo sapiens]
            ACTGTGTGGACATTAAATTAGACTG[G/T]AAGAGTGTAGGCTGCCTTATCTTTG
            Chromosome:
            5:44691293
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.4667/2337
            HGVS:
            NC_000005.10:g.44691293T>G, NC_000005.9:g.44691395T>G
            6.

            rs4415084 [Homo sapiens]
              TGTTGTATTCCTGATGACTTGAGCA[C/T]CCAAGGGAGTGATACATACAGCACT
              Chromosome:
              5:44662413
              Gene:
              LOC102723839 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.4645/2326
              HGVS:
              NC_000005.10:g.44662413C>T, NC_000005.9:g.44662515C>T, XR_427699.2:n.92-3856G>A, XR_925983.1:n.71-3856G>A

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Write to the Help Desk