Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 3

3.

rs137853970 [Homo sapiens]
    ATGCCTGCGTTGTCTTCCTCTCCCC[A/C]GGACCTTTATTGGGCTTGAGGTCAC
    Chromosome:
    16:58017332
    Gene:
    USB1 (GeneView)
    Functional Consequence:
    splice acceptor variant
    Allele Origin:
    A(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000016.10:g.58017332A>C, NC_000016.9:g.58051236A>C, NG_027698.1:g.20960A>C, NM_001195302.1:c.450-2A>C, NM_024598.3:c.504-2A>C, XM_005256144.1:c.351-2A>C, XM_005256144.3:c.351-2A>C, XM_005256145.1:c.351-2A>C, XM_011523328.1:c.465-2A>C, XM_011523329.1:c.351-2A>C

    Display Settings:

    Format
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk