Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 27

1.

rs12700386 [Homo sapiens]
    AGGACATTTCCCAGAGCCTTAGAGC[A/C/G]TGGTGTCTGCTCAGTGGGACTCAAC
    Chromosome:
    7:22723390
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.1332/667
    HGVS:
    NC_000007.13:g.22763009C>G, NC_000007.14:g.22723390C>G, NG_011640.1:g.1244C>G
    2.

    rs12042763 [Homo sapiens]
      GACTATTGTGTACCATAAAAAAAAG[C/G/T]TTTGATCATGTAAAACTTATAGCTC
      Chromosome:
      1:186682744
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1859/931
      HGVS:
      NC_000001.10:g.186651876G>T, NC_000001.11:g.186682744G>T, NG_028206.2:g.2684C>A
      3.

      rs11766273 [Homo sapiens]
        acttaaaagacctaaggccttaagg[A/G]aacatccatggtggtctggtagcac
        Chromosome:
        7:22736044
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.0284/142
        HGVS:
        NC_000007.13:g.22775663G>A, NC_000007.14:g.22736044G>A
        4.

        rs10911902 [Homo sapiens]
          GTGGTCCTATGTTTGTGATCAGTGT[C/T]AGTGATTAGTGCAGATTCTAGGACT
          Chromosome:
          1:186663185
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.1222/612
          HGVS:
          NC_000001.10:g.186632317C>T, NC_000001.11:g.186663185C>T
          5.

          rs10242595 [Homo sapiens]
            attgttcatgattccttctaaccag[A/G]aggattctgcaatgggggctccttg
            Chromosome:
            7:22734612
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.4060/2033
            HGVS:
            NC_000007.13:g.22774231G>A, NC_000007.14:g.22734612G>A
            6.

            rs10156056 [Homo sapiens]
              ccactgggctgtccagaatgcaaga[C/G]agaactcagagttggggacataaac
              Chromosome:
              7:22714469
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.1400/701
              HGVS:
              NC_000007.13:g.22754088G>C, NC_000007.14:g.22714469G>C
              7.

              rs7805828 [Homo sapiens]
                CCTTTTCTTACACTCCCCAAATAGA[A/G]CTCATACAATATAACTAATCTCTGG
                Chromosome:
                7:22718943
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.3335/1670
                HGVS:
                NC_000007.13:g.22758562G>A, NC_000007.14:g.22718943G>A
                8.

                rs7801617 [Homo sapiens]
                  CTGAGAACTCTTCAGGGCTCTCCTC[A/G]TCCTTTTCACTCAGGGCCCCAAAGC
                  Chromosome:
                  7:22718463
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.1969/986
                  HGVS:
                  NC_000007.13:g.22758082G>A, NC_000007.14:g.22718463G>A
                  9.

                  rs7776857 [Homo sapiens]
                    ACTGTACAGGGCTCGGCTAGAGCAA[G/T]GGCCCAGGGAATATCCACCAGAAGG
                    Chromosome:
                    7:22715149
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.1146/574
                    HGVS:
                    NC_000007.13:g.22754768G>T, NC_000007.14:g.22715149G>T
                    10.

                    rs7550380 [Homo sapiens]
                      atgaaaaagcaaaaatgttagaaat[G/T]atattgtatttccacagagtcacac
                      Chromosome:
                      1:186695373
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.2192/1098
                      HGVS:
                      NC_000001.10:g.186664505G>T, NC_000001.11:g.186695373G>T
                      11.

                      rs6969502 [Homo sapiens]
                        ATTCATAAGCCCACCTGCAAAAGGC[A/G]TTCTGAAAGAGCAGAAGACTGAGTG
                        Chromosome:
                        7:22712807
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.4675/2341
                        HGVS:
                        NC_000007.13:g.22752426G>A, NC_000007.14:g.22712807G>A
                        12.

                        rs6952003 [Homo sapiens]
                          AGCTTGGCCTTTACCATAAAGATCA[A/T]GTGAACTACGTAGGGTTTTGAGCAG
                          Chromosome:
                          7:22713086
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.2286/1145
                          HGVS:
                          NC_000007.13:g.22752705T>A, NC_000007.14:g.22713086T>A
                          13.

                          rs6949149 [Homo sapiens]
                            AAGGAGGTCTCCAGGCAAAGGGCAT[G/T]GGGGAGTGAGATTGACCCAACCTTG
                            Chromosome:
                            7:22709538
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.2873/1439
                            HGVS:
                            NC_000007.13:g.22749157G>T, NC_000007.14:g.22709538G>T
                            14.

                            rs4648298 [Homo sapiens]
                              TCTTATTAGGACACTATGGTTATAA[A/G]CTGTGTTTAAGCCTACAATCATTGA
                              Chromosome:
                              1:186672550
                              Gene:
                              PTGS2 (GeneView)
                              Functional Consequence:
                              utr variant 3 prime
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              C=0.0116/58
                              HGVS:
                              NC_000001.10:g.186641682T>C, NC_000001.11:g.186672550T>C, NG_028206.2:g.12878A>G, NM_000963.3:c.*1803A>G
                              15.

                              rs4648261 [Homo sapiens]
                                GGAAGAAGTTGTTTTAAATATTCTA[A/G]TCAGTTCTTTCCTGCTCCCAGGAAA
                                Chromosome:
                                1:186679872
                                Gene:
                                PACERR (GeneView) PTGS2 (GeneView)
                                Functional Consequence:
                                intron variant,upstream variant 2KB
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.0100/50
                                HGVS:
                                NC_000001.10:g.186649004C>T, NC_000001.11:g.186679872C>T, NG_028206.2:g.5556G>A, NM_000963.3:c.52+367G>A, NR_125801.1:n.-782C>T
                                16.

                                rs4552807 [Homo sapiens]
                                  CTTTAAGGTTTTTTAACAACACAAA[A/T]CAGCAACATAGAAGGAACACCAGTA
                                  Chromosome:
                                  7:22711400
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  T=0.2488/1246
                                  HGVS:
                                  NC_000007.13:g.22751019T>A, NC_000007.14:g.22711400T>A
                                  17.

                                  rs2745557 [Homo sapiens]
                                    CTGGAATATCCACGGAGTTCTTTCG[A/G]ACTCTAGCGGTCCAAGCTCTTTCCC
                                    Chromosome:
                                    1:186680089
                                    Gene:
                                    PACERR (GeneView) PTGS2 (GeneView)
                                    Functional Consequence:
                                    intron variant,upstream variant 2KB
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    A=0.1460/731
                                    HGVS:
                                    NC_000001.10:g.186649221A>G, NC_000001.11:g.186680089A>G, NG_028206.2:g.5339T>C, NM_000963.3:c.52+150T>C, NR_125801.1:n.-565A>G
                                    18.

                                    rs2383529 [Homo sapiens]
                                      TTTCCAACATAGTTCAATGAAAGAA[A/G]CACGTAATTTGAAGCACTGACCACA
                                      Chromosome:
                                      1:186699960
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                      Global MAF:
                                      G=0.3021/1513
                                      HGVS:
                                      NC_000001.10:g.186669092A>G, NC_000001.11:g.186699960A>G
                                      19.

                                      rs2206593 [Homo sapiens]
                                        AACAGAAAATCTGAGAAAACATATC[A/G]TTATTCAAGCACAGCTTGGTACTTC
                                        Chromosome:
                                        1:186673297
                                        Gene:
                                        PTGS2 (GeneView)
                                        Functional Consequence:
                                        utr variant 3 prime
                                        Validated:
                                        by 1000G,by cluster,by frequency,by hapmap,by submitter
                                        Global MAF:
                                        A=0.0371/186
                                        HGVS:
                                        NC_000001.10:g.186642429A>G, NC_000001.11:g.186673297A>G, NG_028206.2:g.12131T>C, NM_000963.3:c.*1056T>C
                                        20.

                                        rs2069861 [Homo sapiens]
                                          TGTGTCACGTGAAGCTTAATATAAA[C/T]AAGTTTCTTGTCACTGCCACCACCA
                                          Chromosome:
                                          7:22732035
                                          Gene:
                                          IL6 (GeneView)
                                          Functional Consequence:
                                          downstream variant 500B
                                          Validated:
                                          by 1000G,by cluster,by frequency,by hapmap
                                          Global MAF:
                                          T=0.0222/111
                                          HGVS:
                                          NC_000007.13:g.22771654C>T, NC_000007.14:g.22732035C>T, NG_011640.1:g.9889C>T, NM_000600.4:c.*462C>T, NM_001318095.1:c.*462C>T, XM_005249746.1:c.*462C>T, XM_011515390.1:c.*462C>T, XM_011515391.1:c.*462C>T

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center