Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 6

1.

rs17594526 [Homo sapiens]
    GAAGAAGTTCATGTTAGTGCCTTCT[C/T]TTTGGCTGAGACAGTTACATGGCAG
    Chromosome:
    18:55391007
    Gene:
    TCF4 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.0573/287
    HGVS:
    NC_000018.10:g.55391007C>T, NC_000018.9:g.53058238C>T, NG_011716.2:g.249987G>A, NM_001083962.1:c.369+12447G>A, NM_001243226.2:c.675+12447G>A, NM_001243227.1:c.297+12447G>A, NM_001243228.1:c.369+12447G>A, NM_001243230.1:c.363+12447G>A, NM_001243231.1:c.243+12447G>A, NM_001243232.1:c.159+12447G>A, NM_001243233.1:c.-22+12447G>A, NM_001306207.1:c.297+12447G>A, NM_001306208.1:c.159+12447G>A, NM_003199.2:c.369+12447G>A, XM_005266738.1:c.783+12447G>A, XM_005266739.1:c.639+12447G>A, XM_005266739.3:c.297+12447G>A, XM_005266740.1:c.369+12447G>A, XM_005266741.1:c.369+12447G>A, XM_005266741.3:c.369+12447G>A, XM_005266742.1:c.363+12447G>A, XM_005266743.1:c.297+12447G>A, XM_005266743.3:c.297+12447G>A, XM_005266744.1:c.297+12447G>A, XM_005266744.3:c.297+12447G>A, XM_005266745.1:c.297+12447G>A, XM_005266745.3:c.297+12447G>A, XM_005266746.1:c.297+12447G>A, XM_005266746.3:c.297+12447G>A, XM_005266747.1:c.243+12447G>A, XM_005266747.3:c.243+12447G>A, XM_005266748.1:c.369+12447G>A, XM_005266749.1:c.159+12447G>A, XM_005266749.3:c.159+12447G>A, XM_005266750.1:c.159+12447G>A, XM_005266750.3:c.159+12447G>A, XM_005266751.1:c.-22+12447G>A, XM_005266752.1:c.-22+12447G>A, XM_005266752.3:c.-22+12447G>A, XM_005266753.1:c.-22+12447G>A, XM_005266754.1:c.-22+10573G>A, XM_005266754.3:c.-22+10573G>A, XM_005266755.1:c.-19+12447G>A, XM_005266755.3:c.-19+12447G>A, XM_005266756.1:c.-22+11048G>A, XM_005266757.1:c.-22+9994G>A, XM_005266759.1:c.-22+11048G>A, XM_006722536.2:c.369+12447G>A, XM_006722537.2:c.369+12447G>A, XM_006722538.2:c.297+12447G>A, XM_006722539.2:c.-19+10573G>A, XM_006722540.2:c.-19+10573G>A, XM_011526154.1:c.675+12447G>A, XM_011526155.1:c.675+12447G>A, XM_011526156.1:c.675+12447G>A, XM_011526157.1:c.675+12447G>A, XM_011526158.1:c.363+12447G>A, XM_011526159.1:c.-22+12447G>A, XM_011526160.1:c.-22+9994G>A, XM_011526161.1:c.-22+11048G>A, XM_011526163.1:c.-19+11048G>A, XM_011526164.1:c.-22+11048G>A
    2.

    rs13194053 [Homo sapiens]
      CTGTCTCCCACCACGCACTCCATTT[C/T]TGTCACATTTCAAACCTATCGCTTT
      Chromosome:
      6:27176104
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.0972/487
      HGVS:
      NC_000006.11:g.27143883T>C, NC_000006.12:g.27176104T>C
      3.

      rs7544736 [Homo sapiens]
        ggttttctttgtgtttatcaggctt[A/G]atgttatttgagttctgggatctgg
        Chromosome:
        1:96698787
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.2298/1151
        HGVS:
        NC_000001.10:g.97164343A>G, NC_000001.11:g.96698787A>G
        4.

        rs6782299 [Homo sapiens]
          ACAGAGGTAACCCTCAGATTCAGAC[G/T]AACACAGAAGGCAAAATTTGTCCCA
          Chromosome:
          3:180832914
          Gene:
          LOC101928882 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.1681/842
          HGVS:
          NC_000003.11:g.180550702G>T, NC_000003.12:g.180832914G>T, NR_109986.1:n.250+14593C>A

          Display Settings:

          Format
          Items per page
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Write to the Help Desk