Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 6

3.

rs7546245 [Homo sapiens]
    tggagtcacatgcttatccatgaac[C/T]aaataatcatcgttgacaggaaata
    Chromosome:
    1:67284791
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.3327/1666
    HGVS:
    NC_000001.10:g.67750474T>C, NC_000001.11:g.67284791T>C
    4.

    rs6661505 [Homo sapiens]
      TAGGCTGTTGATCCAACACCAATGG[C/T]CTTGAGATGAGATGTGTTCCCTGTG
      Chromosome:
      1:58891154
      Gene:
      LINC01135 (GeneView) LOC105378753 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.3930/1968
      HGVS:
      NC_000001.10:g.59356826T>C, NC_000001.11:g.58891154T>C, NR_034014.1:n.156-2391T>C, NR_034015.1:n.156-2391T>C, NR_108106.1:n.156-7893T>C, XR_947408.1:n.694-1946A>G, XR_947409.1:n.802-1946A>G, XR_947410.1:n.259-1946A>G, XR_947411.1:n.267-1946A>G, XR_947412.1:n.231-1946A>G, XR_947413.1:n.701-1946A>G
      5.

      rs1035127 [Homo sapiens]
        TCACAAAGTCTTAATATGTCTACCA[C/T]GTAAAAACCTTCCCACAATGATAAT
        Chromosome:
        2:102403459
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.3139/1572
        HGVS:
        NC_000002.11:g.103019919A>G, NC_000002.12:g.102403459A>G

        Display Settings:

        Format
        Items per page
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Write to the Help Desk