Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 9

1.

rs17880887 [Homo sapiens]
    TAAACTCCTGACCTCAGGTGATCCA[A/C]CCACCTCAGCCTCCCAAATTGCTGG
    Chromosome:
    16:31099180
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.1222/612
    HGVS:
    NC_000016.10:g.31099180G>T, NC_000016.9:g.31110501G>T, NG_011564.1:g.776C>A
    2.
    4.

    rs8050894 [Homo sapiens]
      CCACATCCCCACCCGCAGGACGCTC[C/G/T]GTGATGAGCAGCTAGCTGGCTGTCA
      Chromosome:
      16:31093188
      Gene:
      VKORC1 (GeneView)
      Functional Consequence:
      intron variant
      Clinical significance:
      drug-response
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4163/2085
      HGVS:
      NC_000016.10:g.31093188C>G, NC_000016.9:g.31104509C>G, NG_011564.1:g.6768G>C, NM_001311311.1:c.283+124G>C, NM_024006.5:c.283+124G>C, NM_206824.2:c.173+1369G>C, XM_005255568.1:c.283+124G>C, XM_011545943.1:c.283+124G>C, XM_011545944.1:c.283+124G>C, XM_011545945.1:c.173+1369G>C, XR_243303.1:n.832+124G>C, XR_950848.1:n.1071+124G>C
      5.

      rs2884737 [Homo sapiens]
        GCAGCCATCGCCAACACCCCCCTTC[A/C]CCTGCGCGCCGTCCTTGAGACCATC
        Chromosome:
        16:31094233
        Gene:
        VKORC1 (GeneView)
        Functional Consequence:
        intron variant
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.0915/458
        HGVS:
        NC_000016.10:g.31094233A>C, NC_000016.9:g.31105554A>C, NG_011564.1:g.5723T>G, NM_001311311.1:c.173+324T>G, NM_024006.5:c.173+324T>G, NM_206824.2:c.173+324T>G, XM_005255568.1:c.173+324T>G, XM_011545943.1:c.173+324T>G, XM_011545944.1:c.173+324T>G, XM_011545945.1:c.173+324T>G, XR_243303.1:n.822+324T>G, XR_950848.1:n.961+324T>G
        6.
        7.

        rs1799853 [Homo sapiens]
          GATGGGGAAGAGGAGCATTGAGGAC[C/T]GTGTTCAAGAGGAAGCCCGCTGCCT
          Chromosome:
          10:94942290
          Gene:
          CYP2C9 (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          T(germline)/C(germline)
          Clinical significance:
          drug-response
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.0479/240
          HGVS:
          NC_000010.10:g.96702047C, NC_000010.10:g.96702047C>T, NC_000010.11:g.94942290C, NC_000010.11:g.94942290C>T, NG_008385.1:g.8633C, NG_008385.1:g.8633C>T, NM_000771.3:c.430C, NM_000771.3:c.430C>T, NP_000762.2:p.Arg144, NP_000762.2:p.Arg144Cys, XM_005269575.1:c.430C, XM_005269575.1:c.430C>T, XP_005269632.1:p.Arg144, XP_005269632.1:p.Arg144Cys
          8.

          Display Settings:

          Format
          Items per page
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Write to the Help Desk