Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 18

1.

rs35964658 [Homo sapiens]
    TTCTGAAACTTTTCATCAAATGACC[A/G]CACTTTAATTTTCCAGCCTCATGTC
    Chromosome:
    4:141758435
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.1679/841
    HGVS:
    NC_000004.11:g.142679588A>G, NC_000004.12:g.141758435A>G
    2.

    rs35229355 [Homo sapiens]
      AGCAATCTAGATGTATGAAATGAGG[C/T]CCATAAATAATGGAAATGGAATGCT
      Chromosome:
      6:155608667
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1240/621
      HGVS:
      NC_000006.11:g.155929801C>T, NC_000006.12:g.155608667C>T
      3.

      rs17015014 [Homo sapiens]
        TCGGACTGCTGGGTCTAAGAAGCAA[C/G]TTTGCTGTAAAGATGCTAAATATGT
        Chromosome:
        4:141807619
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.2480/1242
        HGVS:
        NC_000004.11:g.142728772G>C, NC_000004.12:g.141807619G>C
        4.

        rs17007695 [Homo sapiens]
          GCTTTCATGTGTACCATTGGCTTTC[C/T]TTGAAAATCACACATTTGTAAATTT
          Chromosome:
          4:141788570
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.1633/818
          HGVS:
          NC_000004.11:g.142709723T>C, NC_000004.12:g.141788570T>C
          5.

          rs13106616 [Homo sapiens]
            GTACTTTAGGCTAATTGACATCTTC[A/G]TTCACAAAGTCCATTGTGGACAATC
            Chromosome:
            4:34041798
            Gene:
            LOC101928622 (GeneView)
            Functional Consequence:
            upstream variant 2KB
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2494/1249
            HGVS:
            NC_000004.11:g.34043420G>A, NC_000004.12:g.34041798G>A, NR_125902.1:n.-1905C>T
            6.

            rs10519613 [Homo sapiens]
              AGACATAACAAAACACTCGGCATTT[A/C]AAATGTGCTGTCAAAACAAGTTTTT
              Chromosome:
              4:141732931
              Gene:
              IL15 (GeneView)
              Functional Consequence:
              nc transcript variant,utr variant 3 prime
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.1739/871
              HGVS:
              NC_000004.11:g.142654084C>A, NC_000004.12:g.141732931C>A, NG_029605.1:g.101336C>A, NM_000585.4:c.*83C>A, NM_172175.2:c.*83C>A, NR_037840.2:n.1422C>A
              7.

              rs10519612 [Homo sapiens]
                TCAATGTCCTTAACCCATTATTGGA[A/C]AAATAAACATATATCAAATCTCCCT
                Chromosome:
                4:141732548
                Gene:
                IL15 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.1741/872
                HGVS:
                NC_000004.11:g.142653701A>C, NC_000004.12:g.141732548A>C, NG_029605.1:g.100953A>C, NM_000585.4:c.379-190A>C, NM_172175.2:c.298-190A>C, NR_037840.2:n.1229-190A>C
                8.

                rs10508343 [Homo sapiens]
                  ATTTTAAATACATACATAGATTAAG[A/C]GGGCAAATTTCCAGAAAAACACAGT
                  Chromosome:
                  10:8108750
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.0617/309
                  HGVS:
                  NC_000010.10:g.8150713C>A, NC_000010.11:g.8108750C>A
                  9.

                  rs7128311 [Homo sapiens]
                    GTTAGAACCTCAGGAACCCACTTCA[C/T]TGTGCAAAGTGATACCATTTCAGGC
                    Chromosome:
                    11:20540973
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.1080/541
                    HGVS:
                    NC_000011.10:g.20540973C>T, NC_000011.9:g.20562519C>T
                    10.

                    rs7115578 [Homo sapiens]
                      GCTTAATAAAACATAACGTTATTGA[A/G]AAGTAAATCTCCCATTGAGCAAATC
                      Chromosome:
                      11:96266936
                      Gene:
                      MAML2 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.4211/2109
                      HGVS:
                      NC_000011.10:g.96266936G>A, NC_000011.9:g.96000100G>A, NM_032427.3:c.513+74447C>T, XM_011543024.1:c.-172+75972C>T, XM_011543025.1:c.513+74447C>T
                      12.

                      rs6125048 [Homo sapiens]
                        gagttgggctcaaatctgcctctct[G/T]aactagagtttgggtgcaggtttta
                        Chromosome:
                        20:47579861
                        Gene:
                        NCOA3 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.1480/741
                        HGVS:
                        NC_000020.10:g.46208605G>T, NC_000020.11:g.47579861G>T, NG_016810.1:g.83005G>T, NM_001174087.1:c.-98-3322G>T, NM_001174088.1:c.-98-3322G>T, NM_006534.3:c.-98-3322G>T, NM_181659.2:c.-98-3322G>T, XM_005260564.1:c.-19-42368G>T, XM_005260565.1:c.-98-3322G>T, XM_005260566.1:c.-98-3322G>T
                        13.

                        rs4723619 [Homo sapiens]
                          TCTGCCTGAGAAGCTGTTGCTGATA[C/T]TGTCAAGCACCCTCCGCCTCCATCT
                          Chromosome:
                          7:37226747
                          Gene:
                          ELMO1 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.1180/591
                          HGVS:
                          NC_000007.13:g.37266352T>C, NC_000007.14:g.37226747T>C, NM_001206480.2:c.550-1717A>G, NM_001206482.1:c.550-1717A>G, NM_014800.10:c.550-1717A>G, XM_005249919.1:c.550-1717A>G, XM_005249920.1:c.550-1717A>G, XM_006715805.1:c.550-1717A>G, XM_011515654.1:c.550-1717A>G, XM_011515655.1:c.550-1717A>G
                          14.

                          rs2901286 [Homo sapiens]
                            AAGTCTTTGAAGATAAAAGGATTGT[A/C]TTAACTTATCTTAGATGGTTGCCCA
                            Chromosome:
                            10:121141109
                            Gene:
                            LOC105378522 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            A=0.0565/283
                            HGVS:
                            NC_000010.10:g.122900623C>A, NC_000010.11:g.121141109C>A, XR_946379.1:n.286-10939C>A
                            15.

                            rs1569175 [Homo sapiens]
                              AGTGGTAATGAAGAGGTATCAATAA[A/G]TAACTTCGATGATGATGAGGAAGAA
                              Chromosome:
                              2:200157231
                              Gene:
                              LOC105373834 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              T=0.1514/758
                              HGVS:
                              NC_000002.11:g.201021954T>C, NC_000002.12:g.200157231T>C, XR_923778.1:n.177+17339A>G
                              16.

                              rs1486649 [Homo sapiens]
                                CATTTTCTTGAGCTTTAATTGTAGT[G/T]ATTTGTAGTTATTGATAATAGCACA
                                Chromosome:
                                8:61235436
                                Gene:
                                CLVS1 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                C=0.3389/1697
                                HGVS:
                                NC_000008.10:g.62147995A>C, NC_000008.11:g.61235436A>C, XM_011517472.1:c.-151-64241A>C
                                17.

                                rs359312 [Homo sapiens]
                                  gatcttcaaaggaacctccatatgt[A/G]acttgagcttcttgcagctcaagaa
                                  Chromosome:
                                  10:17346144
                                  Gene:
                                  ST8SIA6 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  T=0.1128/565
                                  HGVS:
                                  NC_000010.10:g.17388143C>T, NC_000010.11:g.17346144C>T, NM_001004470.1:c.377+13370G>A, XR_242697.1:n.531+13370G>A, XR_242697.2:n.503+13370G>A
                                  18.

                                  rs267759 [Homo sapiens]
                                    TATAATCTCAAAGTGCCAGAAATAT[A/G]TGAATCTCAATTTTAATGAATAGGT
                                    Chromosome:
                                    5:36137518
                                    Gene:
                                    LMBRD2 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    A=0.1148/575
                                    HGVS:
                                    NC_000005.10:g.36137518A>G, NC_000005.9:g.36137620A>G, NM_001007527.1:c.369-77T>C, XM_011514162.1:c.369-77T>C

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Write to the Help Desk