Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 24

1.

rs17728338 [Homo sapiens]
    CTGGCACCGAGCTCTTAGTAGGACC[A/G]TTGCAAAAGGCTCCCGAATGGCACC
    Chromosome:
    5:151098757
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0988/495
    HGVS:
    NC_000005.10:g.151098757G>A, NC_000005.9:g.150478318G>A
    2.

    rs13192841 [Homo sapiens]
      ggattccaggcagttccctatgtta[A/G]tctcggggtctctgtgggtccaggg
      Chromosome:
      6:137646077
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.2019/1011
      HGVS:
      NC_000006.11:g.137967214G>A, NC_000006.12:g.137646077G>A
      5.

      rs12807920 [Homo sapiens]
        AAAATCAGAAAGCAGGTTCCTGAGA[C/T]TGTGAGTTATCAAGATATAAAACTG
        Chromosome:
        11:99620806
        Gene:
        CNTN5 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.4669/2338
        HGVS:
        NC_000011.10:g.99620806C>T, NC_000011.9:g.99491537C>T, NM_001243270.1:c.55+64537C>T, NM_001243271.1:c.55+64537C>T, NM_014361.3:c.55+64537C>T, NM_175566.2:c.55+64537C>T, XM_011542871.1:c.55+64537C>T, XM_011542872.1:c.55+64537C>T, XM_011542873.1:c.55+64537C>T
        8.

        rs10499194 [Homo sapiens]
          AATATTGATTTTCTTCAAATGTGTT[C/T]AACCCTTTTGTTCAAAAAGTAGTCA
          Chromosome:
          6:137681500
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.1915/959
          HGVS:
          NC_000006.11:g.138002637C>T, NC_000006.12:g.137681500C>T
          9.

          rs10077785 [Homo sapiens]
            CTCTCCCTAGCCCTTGCTTTGCCTC[C/T]GTTACCTACATAGATGGGCTTCACA
            Chromosome:
            5:132465466
            Gene:
            C5orf56 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.1673/838
            HGVS:
            NC_000005.10:g.132465466C>T, NC_000005.9:g.131801158C>T, NR_045116.1:n.428-10201C>T
            10.

            rs6922466 [Homo sapiens]
              CTGGGGAAGTTTTTGGGTTTTGTTT[A/G]TTTTTAATTCAAAGCaaagcatata
              Chromosome:
              6:138123793
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.2344/1174
              HGVS:
              NC_000006.11:g.138444930A>G, NC_000006.12:g.138123793A>G
              11.

              rs6920220 [Homo sapiens]
                TTAGCAGGTAACTTCTCCACTAAAA[A/G]GATATGGTTCTGTAGAACAATGGCA
                Chromosome:
                6:137685367
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.0944/473
                HGVS:
                NC_000006.11:g.138006504G>A, NC_000006.12:g.137685367G>A
                12.

                rs5029939 [Homo sapiens]
                  GTCACCTAAACTAGTTAGGAGCAGA[C/G]TTAAGCTAGAACCAAGGTCCCCTGG
                  Chromosome:
                  6:137874586
                  Gene:
                  TNFAIP3 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.1396/699
                  HGVS:
                  NC_000006.11:g.138195723C>G, NC_000006.12:g.137874586C>G, NG_032761.1:g.12143C>G, NM_001270507.1:c.296-259C>G, NM_001270508.1:c.296-259C>G, NM_006290.3:c.296-259C>G, XM_005267119.1:c.296-259C>G, XM_006715555.1:c.-356-259C>G, XM_011536095.1:c.296-259C>G, XM_011536096.1:c.296-259C>G
                  13.

                  rs4112788 [Homo sapiens]
                    AAACCTTTAGACTACAATTAAAAGA[C/T]GGGTAAAGAAAAACATGGCCTCAGC
                    Chromosome:
                    1:152578800
                    Validated:
                    no info
                    Global MAF:
                    A=0.3265/1635
                    HGVS:
                    NC_000001.10:g.152551276A>G, NC_000001.11:g.152578800A>G
                    16.

                    rs2082412 [Homo sapiens]
                      CAACCAAGAAATAGTCATTTACAGA[A/G]CATTTTGCATTTGTACAATTTCACT
                      Chromosome:
                      5:159290781
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.3716/1861
                      HGVS:
                      NC_000005.10:g.159290781G>A, NC_000005.9:g.158717789G>A
                      17.

                      rs2066808 [Homo sapiens]
                        TAGCTTCTGCTTATTCTACCATTCC[C/T]GATTTCATTTGAACCACTGAGCCCT
                        Chromosome:
                        12:56344189
                        Gene:
                        STAT2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        G=0.1953/978
                        HGVS:
                        NC_000012.11:g.56737973A>G, NC_000012.12:g.56344189A>G, NG_046314.1:g.21065T>C, NM_005419.3:c.2103-54T>C, NM_198332.1:c.2091-54T>C, XM_005269108.1:c.2307-54T>C, XM_005269109.1:c.2295-54T>C, XM_011538697.1:c.2127-54T>C, XM_011538698.1:c.2115-54T>C, XM_011538700.1:c.1395-54T>C, XM_011538701.1:c.1158-54T>C
                        19.

                        rs2022544 [Homo sapiens]
                          CTAGCCACCCTGCTGTGCTCTTAGA[A/G]TTCTAATAATTTTCAGATTCTTTTG
                          Chromosome:
                          6:32353227
                          Gene:
                          C6orf10 (GeneView) LOC101929163 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.1795/899
                          HGVS:
                          NC_000006.11:g.32321004C>T, NC_000006.12:g.32353227C>T, NM_001286474.1:c.259+1897G>A, NM_001286475.1:c.238+1897G>A, NM_006781.4:c.259+1897G>A, NT_113891.3:g.3791349C>T, NT_167244.1:g.3635381C>T, NT_167244.2:g.3685465C>T, NT_167245.2:g.3594340C>T, NT_167246.2:g.3658231C>T, NT_167247.1:g.3700566C>T, NT_167247.2:g.3694981C>T, NT_167248.2:g.3576270C>T, NT_167249.2:g.3669152C>T, XM_005248809.1:c.259+1897G>A, XM_005248810.1:c.238+1897G>A, XM_005272765.1:c.259+1893G>A, XM_005272766.1:c.238+1893G>A, XM_005274911.1:c.259+1893G>A, XM_005274912.1:c.238+1893G>A, XM_005274912.2:c.238+1893G>A, XM_005275077.1:c.259+1897G>A, XM_005275078.1:c.238+1897G>A, XM_005275341.1:c.259+1892G>A, XM_005275342.1:c.238+1892G>A, XM_005275342.2:c.238+1892G>A, XM_005275508.1:c.259+1893G>A, XM_005275509.1:c.238+1893G>A, XM_006725674.2:c.238+1893G>A, XM_006725973.2:c.238+1892G>A, XM_011514235.1:c.238+1897G>A, XM_011514236.1:c.238+1897G>A, XM_011514237.1:c.292+1897G>A, XM_011514238.1:c.238+1897G>A, XM_011514239.1:c.271+1897G>A, XM_011514240.1:c.259+1897G>A, XM_011514241.1:c.238+1897G>A, XM_011514242.1:c.259+1897G>A, XM_011514243.1:c.238+1897G>A, XM_011514244.1:c.238+1897G>A, XM_011514245.1:c.238+1897G>A, XM_011514246.1:c.238+1897G>A, XM_011515039.1:c.422-12553C>T, XM_011515040.1:c.422-12553C>T, XM_011547172.1:c.259+1893G>A, XM_011547173.1:c.292+1893G>A, XM_011547174.1:c.259+1893G>A, XM_011547175.1:c.271+1893G>A, XM_011547176.1:c.259+1893G>A, XM_011547177.1:c.238+1893G>A, XM_011547178.1:c.259+1893G>A, XM_011547179.1:c.238+1893G>A, XM_011547338.1:c.422-12557C>T, XM_011547339.1:c.422-12557C>T, XM_011547587.1:c.238+1893G>A, XM_011547588.1:c.238+1893G>A, XM_011547589.1:c.292+1893G>A, XM_011547590.1:c.238+1893G>A, XM_011547591.1:c.271+1893G>A, XM_011547592.1:c.238+1893G>A, XM_011547593.1:c.238+1893G>A, XM_011547594.1:c.238+1893G>A, XM_011547826.1:c.292+1897G>A, XM_011547827.1:c.292+1897G>A, XM_011547828.1:c.292+1897G>A, XM_011547829.1:c.271+1897G>A, XM_011547830.1:c.259+1897G>A, XM_011547831.1:c.259+1897G>A, XM_011547832.1:c.238+1897G>A, XM_011547833.1:c.238+1897G>A, XM_011547834.1:c.238+1897G>A, XM_011547954.1:c.422-12551C>T, XM_011547955.1:c.422-12551C>T, XM_011548183.1:c.238+1892G>A, XM_011548184.1:c.238+1892G>A, XM_011548185.1:c.292+1892G>A, XM_011548186.1:c.238+1892G>A, XM_011548187.1:c.271+1892G>A, XM_011548188.1:c.238+1892G>A, XM_011548189.1:c.238+1892G>A, XM_011548190.1:c.238+1892G>A, XM_011548322.1:c.422-12555C>T, XM_011548323.1:c.422-12555C>T, XM_011548382.1:c.292+1893G>A, XM_011548508.1:c.422-12552C>T, XM_011548509.1:c.422-12552C>T
                          20.

                          rs1076160 [Homo sapiens]
                            TTCAGACCCAGACAGTATGTCTCCC[A/G]CATGGCATAGAGAATGGCTTGATGA
                            Chromosome:
                            9:132900647
                            Gene:
                            TSC1 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.4123/2065
                            HGVS:
                            NC_000009.11:g.135776034C>T, NC_000009.12:g.132900647C>T, NG_012386.1:g.48987G>A, NM_000368.3:c.2625+68G>A, NM_000368.4:c.2625+68G>A, NM_001162426.1:c.2622+68G>A, NM_001162427.1:c.2472+68G>A, XM_005272211.1:c.2625+68G>A, XM_005272212.1:c.2625+68G>A, XM_006717271.1:c.2625+68G>A, XM_011518979.1:c.2625+68G>A

                            Display Settings:

                            Format
                            Items per page
                            Sort by

                            Send to:

                            Choose Destination

                            Supplemental Content

                            Find related data

                            Recent activity

                            Your browsing activity is empty.

                            Activity recording is turned off.

                            Turn recording back on

                            See more...
                            Write to the Help Desk