Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 25

1.

rs13192841 [Homo sapiens]
    ggattccaggcagttccctatgtta[A/G]tctcggggtctctgtgggtccaggg
    Chromosome:
    6:137646077
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2019/1011
    HGVS:
    NC_000006.11:g.137967214G>A, NC_000006.12:g.137646077G>A
    2.

    rs12661926 [Homo sapiens]
      AGATAAAAATGATTTAAAAATCCCT[A/G]TATGTGCTTCTTTTATTTAAAAAAT
      Chromosome:
      6:138126973
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.2604/1304
      HGVS:
      NC_000006.11:g.138448110A>G, NC_000006.12:g.138126973A>G
      3.

      rs12660547 [Homo sapiens]
        CTGGTCACTAATTTTAAATGACAGG[C/T]GAATGGCTCACAAACATTTAAGAGA
        Chromosome:
        6:138126925
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.2606/1305
        HGVS:
        NC_000006.11:g.138448062T>C, NC_000006.12:g.138126925T>C
        4.

        rs12527282 [Homo sapiens]
          tgtgggtccaggggctcttccgtgg[C/T]taggactgcgggagtcctcagtggg
          Chromosome:
          6:137646115
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2055/1029
          HGVS:
          NC_000006.11:g.137967252C>T, NC_000006.12:g.137646115C>T
          5.

          rs10499194 [Homo sapiens]
            AATATTGATTTTCTTCAAATGTGTT[C/T]AACCCTTTTGTTCAAAAAGTAGTCA
            Chromosome:
            6:137681500
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.1915/959
            HGVS:
            NC_000006.11:g.138002637C>T, NC_000006.12:g.137681500C>T
            6.

            rs9494941 [Homo sapiens]
              TCTCCCAAGCTGCAGTGACATGATC[C/T]CCCTGCCACCGTTCTGGGCATCTCT
              Chromosome:
              6:138110216
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.4700/2354
              HGVS:
              NC_000006.11:g.138431353T>C, NC_000006.12:g.138110216T>C
              7.

              rs7773257 [Homo sapiens]
                ATTGCATTTAGGGTGGGCCTAACTT[C/T]AGTATTACTTCAGCTTAGCTAATTA
                Chromosome:
                6:138128418
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.1611/807
                HGVS:
                NC_000006.11:g.138449555T>C, NC_000006.12:g.138128418T>C
                8.

                rs6933404 [Homo sapiens]
                  TCAATTTCTTCAGATGCTAGTGGTG[C/T]TTCTTGTAATTGTCAAAGCAGTGAA
                  Chromosome:
                  6:137638098
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.0952/477
                  HGVS:
                  NC_000006.11:g.137959235T>C, NC_000006.12:g.137638098T>C
                  9.

                  rs6922466 [Homo sapiens]
                    CTGGGGAAGTTTTTGGGTTTTGTTT[A/G]TTTTTAATTCAAAGCaaagcatata
                    Chromosome:
                    6:138123793
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.2344/1174
                    HGVS:
                    NC_000006.11:g.138444930A>G, NC_000006.12:g.138123793A>G
                    10.

                    rs6920846 [Homo sapiens]
                      ATTCCATGTGTGTTTTTTTGAGTTT[A/G]AGAGGTACAAATAAAATGtgatatg
                      Chromosome:
                      6:138128932
                      Validated:
                      no info
                      Global MAF:
                      G=0.4185/2096
                      HGVS:
                      NC_000006.11:g.138450069A>G, NC_000006.12:g.138128932A>G
                      11.

                      rs6920220 [Homo sapiens]
                        TTAGCAGGTAACTTCTCCACTAAAA[A/G]GATATGGTTCTGTAGAACAATGGCA
                        Chromosome:
                        6:137685367
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.0944/473
                        HGVS:
                        NC_000006.11:g.138006504G>A, NC_000006.12:g.137685367G>A
                        12.

                        rs6904167 [Homo sapiens]
                          CATTTCAAGAGATTATCGAGAAAAT[A/G]AATGTGAGAAGAGCTTGGTGAGATG
                          Chromosome:
                          6:137666771
                          Gene:
                          LOC102723649 (GeneView) LOC105378018 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.4688/2348
                          HGVS:
                          NC_000006.11:g.137987908G>A, NC_000006.12:g.137666771G>A, NR_125867.1:n.94+1032G>A, XR_943059.1:n.278-2653C>T
                          13.

                          rs4896318 [Homo sapiens]
                            ccaagcaggctcctgggggtcccca[A/G]ttccaggccactttgctgtttagaa
                            Chromosome:
                            6:138130137
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.4331/2169
                            HGVS:
                            NC_000006.11:g.138451274G>A, NC_000006.12:g.138130137G>A
                            14.

                            rs2484066 [Homo sapiens]
                              GGGAAATAGTTCAGGGGCATTCAGG[G/T]CCCCTCAGCAGGGGGCTCACAGCAG
                              Chromosome:
                              6:138095981
                              Gene:
                              PERP (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.3704/1855
                              HGVS:
                              NC_000006.11:g.138417118T>G, NC_000006.12:g.138095981T>G, NM_022121.4:c.355+373A>C
                              15.

                              rs2327832 [Homo sapiens]
                                TAAAAAAAAATTCTTAAATGAAAAA[A/G]AAAGGACACCTCAACTGAAGATGAG
                                Chromosome:
                                6:137651931
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                G=0.0954/478
                                HGVS:
                                NC_000006.11:g.137973068A>G, NC_000006.12:g.137651931A>G
                                16.
                                17.

                                rs1931867 [Homo sapiens]
                                  aaaggaatgctttactccgttggga[A/G]gaatgtaaattagttcaaccattgt
                                  Chromosome:
                                  6:138119701
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  T=0.4631/2319
                                  HGVS:
                                  NC_000006.11:g.138440838T>C, NC_000006.12:g.138119701T>C
                                  18.

                                  rs1002658 [Homo sapiens]
                                    ATTAAAAATAGGAACAGAAAGAGGT[A/G]GACTAAGCAGATGGTATTCTGGACT
                                    Chromosome:
                                    6:137660447
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    T=0.1312/657
                                    HGVS:
                                    NC_000006.11:g.137981584C>T, NC_000006.12:g.137660447C>T
                                    19.

                                    rs686851 [Homo sapiens]
                                      ACTAGCGTGACGGACCCAATCTAAT[C/T]TGTTGtctaggtctcagttttctca
                                      Chromosome:
                                      6:137658834
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                      Global MAF:
                                      C=0.4645/2326
                                      HGVS:
                                      NC_000006.11:g.137979971C>T, NC_000006.12:g.137658834C>T
                                      20.

                                      rs648802 [Homo sapiens]
                                        CCAGTTATAGATGTAAGTGACAGCA[C/G]GGTTGGCATGAAGGGTGAAGGTCTG
                                        Chromosome:
                                        6:138092196
                                        Gene:
                                        PERP (GeneView)
                                        Functional Consequence:
                                        missense
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                        Global MAF:
                                        G=0.3688/1847
                                        HGVS:
                                        NC_000006.11:g.138413333G>C, NC_000006.12:g.138092196G>C, NM_022121.4:c.428C>G, NP_071404.2:p.Pro143Arg

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Write to the Help Desk