Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 65

1.

rs16934131 [Homo sapiens]
    TCACATTTTCCAACTCAAGCTAAGT[C/T]AGATTCATCCACCCAGTACTTTGGA
    Chromosome:
    10:76977837
    Gene:
    KCNMA1-AS1 (GeneView) KCNMA1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1717/860
    HGVS:
    NC_000010.10:g.78737595T>C, NC_000010.11:g.76977837T>C, NG_012270.1:g.664983A>G, NM_001014797.2:c.2105-7770A>G, NM_001161352.1:c.2267-7770A>G, NM_001161353.1:c.2093-7770A>G, NM_001271518.1:c.1943-7770A>G, NM_001271519.1:c.2102-7770A>G, NM_002247.3:c.2093-7770A>G, NR_120655.1:n.652+33T>C, XM_005269773.1:c.2267-7770A>G, XM_005269774.1:c.2102-7770A>G, XM_005269775.1:c.2102-7770A>G, XM_005269776.1:c.2093-7770A>G, XM_005269776.2:c.2093-7770A>G, XM_005269777.1:c.2279-7770A>G, XM_005269778.1:c.2279-7770A>G, XM_005269779.1:c.2105-3264A>G, XM_005269780.1:c.2288-7770A>G, XM_005269781.1:c.2267-7770A>G, XM_005269782.1:c.2267-7770A>G, XM_005269783.1:c.2114-7770A>G, XM_005269784.1:c.2102-7770A>G, XM_005269785.1:c.2105-7770A>G, XM_005269786.1:c.2102-7770A>G, XM_005269787.1:c.2093-7770A>G, XM_005269787.2:c.2093-7770A>G, XM_005269788.1:c.2105-3264A>G, XM_005269789.1:c.2105-7770A>G, XM_005269790.1:c.2093-7770A>G, XM_005269791.1:c.2105-7770A>G, XM_005269792.1:c.2093-3264A>G, XM_005269793.1:c.2102-7770A>G, XM_005269794.1:c.2102-7770A>G, XM_005269795.1:c.2105-7770A>G, XM_005269796.1:c.2093-7770A>G, XM_005269797.1:c.2093-7770A>G, XM_005269798.1:c.1940-7770A>G, XM_005269799.1:c.2093-7770A>G, XM_006717826.1:c.2093-7770A>G, XM_011539773.1:c.2411-7770A>G, XM_011539774.1:c.2237-3264A>G, XM_011539775.1:c.2399-7770A>G, XM_011539776.1:c.2399-7770A>G, XM_011539777.1:c.2279-7770A>G, XM_011539778.1:c.2267-7770A>G, XM_011539779.1:c.2225-3264A>G, XM_011539780.1:c.2279-7770A>G, XM_011539781.1:c.2237-7770A>G, XM_011539782.1:c.2225-7770A>G, XM_011539783.1:c.2105-3264A>G, XM_011539785.1:c.2102-7770A>G
    2.

    rs13213247 [Homo sapiens]
      ATGGGATGAATCACCCAGCAGGGCA[A/C]GTAAAGTGACTCTATTTACATGCTA
      Chromosome:
      6:80806319
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.1164/583
      HGVS:
      NC_000006.11:g.81516036A>C, NC_000006.12:g.80806319A>C
      3.

      rs12725861 [Homo sapiens]
        gacatgaaaatttaggcttccagga[A/G]gtttaaagggtgagtgaagcagggt
        Chromosome:
        1:89100413
        Gene:
        LOC105378841 (GeneView)
        Functional Consequence:
        nc transcript variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.3417/1711
        HGVS:
        NC_000001.10:g.89566096G>A, NC_000001.11:g.89100413G>A, XR_947575.1:n.5298G>A, XR_947576.1:n.2288G>A
        4.

        rs12639920 [Homo sapiens]
          GACGATGGGACAAAGAGGCTCAAAT[G/T]AGTCACATTTCAGATCATGTTACAC
          Chromosome:
          4:42410670
          Gene:
          ATP8A1 (GeneView)
          Functional Consequence:
          nc transcript variant,utr variant 3 prime
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.3896/1951
          HGVS:
          NC_000004.11:g.42412687T>G, NC_000004.12:g.42410670T>G, NM_001105529.1:c.*2246A>C, NM_006095.2:c.*2246A>C, XM_005248043.1:c.*2246A>C, XM_005248043.2:c.*2246A>C, XM_011513615.1:c.*2246A>C, XM_011513616.1:c.*2246A>C, XM_011513618.1:c.*2246A>C, XM_011513619.1:c.*2246A>C, XR_925118.1:n.5795A>C
          6.

          rs12146962 [Homo sapiens]
            TTCTTTATACCACAGAATACAACTG[C/T]GGAAGTGTGTTTTCACTATATTTTG
            Chromosome:
            14:32911892
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4036/2021
            HGVS:
            NC_000014.8:g.33381098T>C, NC_000014.9:g.32911892T>C
            9.

            rs11683103 [Homo sapiens]
              TCATTGCAGGAACTTTCCCAAAAAC[A/G]CCAATTGTTCAATGGAAAGCATCAG
              Chromosome:
              2:34687783
              Gene:
              LINC01320 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.3878/1942
              HGVS:
              NC_000002.11:g.34912850G>A, NC_000002.12:g.34687783G>A, NR_126404.1:n.371+9856G>A
              10.

              rs11653716 [Homo sapiens]
                GCTTGAATCTGGTTTAGACCCTAAC[C/G]CTGCTCAGCACCTGCTCTGGTGCGG
                Chromosome:
                17:27757506
                Gene:
                NOS2 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.1675/839
                HGVS:
                NC_000017.10:g.26084532C>G, NC_000017.11:g.27757506C>G, NG_011470.1:g.48024G>C, NM_000625.4:c.3355-153G>C, XM_011524859.1:c.3355-153G>C, XM_011524860.1:c.3352-153G>C, XM_011524861.1:c.3283-153G>C, XM_011524862.1:c.2689-153G>C
                11.

                rs11610206 [Homo sapiens]
                  ATAGAGGTGATCTTTAGCCTCCCTA[C/T]GCTTTATAAACCTAGCCCATTGTGC
                  Chromosome:
                  12:47245743
                  Gene:
                  LOC105369746 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.1050/526
                  HGVS:
                  NC_000012.11:g.47639526T>C, NC_000012.12:g.47245743T>C, XR_944896.1:n.909+3808A>G
                  12.

                  rs11583200 [Homo sapiens]
                    AAAAGCAGCGATTTGGAAGCTTTGT[C/T]TAGGAAAGGTTGCATTTGTTAATTT
                    Chromosome:
                    1:50094148
                    Gene:
                    ELAVL4 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.3566/1786
                    HGVS:
                    NC_000001.10:g.50559820C>T, NC_000001.11:g.50094148C>T, NM_001144777.2:c.18+45966C>T, XM_011540892.1:c.18+45966C>T
                    13.

                    rs11244841 [Homo sapiens]
                      TCAAAATGTAAATGCAATCTTGTGA[C/T]ACAAATAGAAAGATGTTTTAGAAGG
                      Chromosome:
                      10:126145997
                      Gene:
                      ADAM12 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.1597/800
                      HGVS:
                      NC_000010.10:g.127834566T>C, NC_000010.11:g.126145997T>C, NG_029050.1:g.247562A>G, NM_001288973.1:c.339+9230A>G, NM_001288974.1:c.339+9230A>G, NM_001288975.1:c.339+9230A>G, NM_003474.5:c.348+9221A>G, NM_021641.4:c.348+9221A>G, XM_005270188.1:c.339+9230A>G, XM_005270189.1:c.339+9230A>G, XM_005270190.1:c.339+9230A>G
                      14.

                      rs11218343 [Homo sapiens]
                        GTGAGCCACTGCACCCAGCCGGTAA[C/T]AGAGTATTTTAAAATAACATCATAT
                        Chromosome:
                        11:121564878
                        Gene:
                        SORL1 (GeneView)
                        Functional Consequence:
                        intron variant,upstream variant 2KB
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.1090/546
                        HGVS:
                        NC_000011.10:g.121564878T>C, NC_000011.9:g.121435587T>C, NG_023313.1:g.117627T>C, NM_003105.5:c.3050-2062T>C, XM_011542963.1:c.3050-2062T>C, XM_011542964.1:c.3050-2062T>C, XM_011542965.1:c.1511-2062T>C, XM_011542966.1:c.410-2062T>C, XM_011542967.1:c.-2085T>C
                        15.

                        rs11218342 [Homo sapiens]
                          GCCACTAGCTGGTTTTTAAATGGTA[C/T]AACTGGAATTTATTCTTTGTAAAGT
                          Chromosome:
                          11:121563719
                          Gene:
                          SORL1 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.0425/213
                          HGVS:
                          NC_000011.10:g.121563719T>C, NC_000011.9:g.121434428T>C, NG_023313.1:g.116468T>C, NM_003105.5:c.3050-3221T>C, XM_011542963.1:c.3050-3221T>C, XM_011542964.1:c.3050-3221T>C, XM_011542965.1:c.1511-3221T>C, XM_011542966.1:c.410-3221T>C
                          16.

                          rs11205641 [Homo sapiens]
                            ATCATTTAGAGCCCTGGATAAGGCA[A/G]TTTACCAAATGGTGCCTGCCTCCCC
                            Chromosome:
                            1:49719403
                            Gene:
                            AGBL4 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.2887/1446
                            HGVS:
                            NC_000001.10:g.50185075A>G, NC_000001.11:g.49719403A>G, NM_032785.3:c.158-21966T>C, XM_005271284.1:c.158-21966T>C, XM_006710986.2:c.158-21966T>C, XM_011542308.1:c.158-21966T>C, XM_011542309.1:c.158-21966T>C, XM_011542310.1:c.158-21966T>C, XM_011542311.1:c.158-21966T>C
                            17.

                            rs10922573 [Homo sapiens]
                              gttctctgccaggtttctctaccac[A/G]aagtgttatgtaccattttgtcact
                              Chromosome:
                              1:89122697
                              Gene:
                              GBP2 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.3460/1733
                              HGVS:
                              NC_000001.10:g.89588380A>G, NC_000001.11:g.89122697A>G, NM_004120.4:c.-17-714T>C, XM_005270740.1:c.-17-714T>C
                              18.

                              rs10786828 [Homo sapiens]
                                CTTTGCTATCTCCCAAATAATTAAC[A/G]TGGAAGGCAGGGTGGGGCCATGCAT
                                Chromosome:
                                10:104850142
                                Gene:
                                SORCS3 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                G=0.4571/2289
                                HGVS:
                                NC_000010.10:g.106609900A>G, NC_000010.11:g.104850142A>G, NM_014978.2:c.695+7283A>G, XM_011539541.1:c.695+7283A>G
                                19.
                                20.

                                rs9659092 [Homo sapiens]
                                  TCCAATTCTCTTTCACTATCATCTA[A/G]GAGTAAATCTACTTTTCTCTTTCTG
                                  Chromosome:
                                  1:49977917
                                  Gene:
                                  AGBL4 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  G=0.2644/1324
                                  HGVS:
                                  NC_000001.10:g.50443589A>G, NC_000001.11:g.49977917A>G, NM_032785.3:c.34+45846T>C, XM_005271284.1:c.34+45846T>C, XM_006710986.2:c.34+45846T>C, XM_011542308.1:c.34+45846T>C, XM_011542309.1:c.34+45846T>C, XM_011542310.1:c.34+45846T>C, XM_011542311.1:c.34+45846T>C

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Write to the Help Desk