Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 21

1.

rs17366743 [Homo sapiens]
    AGAACCTGGAGAAGGTGYCTATGTA[C/T]ACCGCTCAGCATTCAGTGTGGGATT
    Chromosome:
    3:186854300
    Gene:
    ADIPOQ-AS1 (GeneView) ADIPOQ (GeneView)
    Functional Consequence:
    missense,nc transcript variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0114/57
    HGVS:
    NC_000003.11:g.186572089T>C, NC_000003.12:g.186854300T>C, NG_021140.1:g.16627T>C, NM_001177800.1:c.331T>C, NM_004797.3:c.331T>C, NP_001171271.1:p.Tyr111His, NP_004788.1:p.Tyr111His, NR_046662.1:n.1824A>G, XM_011513324.1:c.331T>C, XP_011511626.1:p.Tyr111His
    2.

    rs12535747 [Homo sapiens]
      TGGCCCAATCCCTGTCCTCTTAAAA[A/C]CTAAGGGAGGAGATGGAAAGGGGCA
      Chromosome:
      7:128238282
      Gene:
      LOC105375494 (GeneView)
      Functional Consequence:
      upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.2546/1275
      HGVS:
      NC_000007.13:g.127878335C>A, NC_000007.14:g.128238282C>A, NG_007450.1:g.2005C>A, XR_927945.1:n.-1484G>T
      3.

      rs12535708 [Homo sapiens]
        CTGGCTTTTCCTGTTCCCTCCGCAT[A/C]ATCACTGCAGGTGTGTTTTCCCAAG
        Chromosome:
        7:128238045
        Gene:
        LOC105375494 (GeneView)
        Functional Consequence:
        upstream variant 2KB
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.2620/1312
        HGVS:
        NC_000007.13:g.127878098C>A, NC_000007.14:g.128238045C>A, NG_007450.1:g.1768C>A, XR_927945.1:n.-1247G>T
        4.

        rs11763517 [Homo sapiens]
          CTTAGGTATTAGAGGGTGGCCATTA[C/T]TTGAGAGTGACTATGACCACAGTTA
          Chromosome:
          7:128250009
          Gene:
          LEP (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.3189/1597
          HGVS:
          NC_000007.13:g.127890062T>C, NC_000007.14:g.128250009T>C, NG_007450.1:g.13732T>C, NM_000230.2:c.-28-1982T>C, XM_005250340.1:c.-28-1982T>C, XM_005250340.3:c.-28-1982T>C
          5.

          rs7799039 [Homo sapiens]
            TTGTTTTGTTTTGCGACAGGGTTGC[A/G]Ctgatcctcccgcctcagtctccct
            Chromosome:
            7:128238730
            Gene:
            LOC105375494 (GeneView)
            Functional Consequence:
            upstream variant 2KB
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.4016/2011
            HGVS:
            NC_000007.13:g.127878783G>A, NC_000007.14:g.128238730G>A, NG_007450.1:g.2453G>A, XR_927945.1:n.-1932C>T
            8.

            rs2241766 [Homo sapiens]
              TTCTACTGCTATTAGCTCTGCCCGG[G/T]CATGACCAGGAAACCACGACTCAAG
              Chromosome:
              3:186853103
              Gene:
              ADIPOQ-AS1 (GeneView) ADIPOQ (GeneView)
              Functional Consequence:
              nc transcript variant,synonymous codon
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              G=0.1514/758
              HGVS:
              NC_000003.11:g.186570892T>G, NC_000003.12:g.186853103T>G, NG_021140.1:g.15430T>G, NM_001177800.1:c.45T>G, NM_004797.3:c.45T>G, NP_001171271.1:p.Gly15, NP_004788.1:p.Gly15, NR_046662.1:n.2226A>C, XM_011513324.1:c.45T>G, XP_011511626.1:p.Gly15
              9.

              rs2167270 [Homo sapiens]
                GAGCCCCGTAGGAATCGCAGCGCCA[A/G]CGGTTGCAAGGTAAGGCCCCGGCGC
                Chromosome:
                7:128241296
                Gene:
                LEP (GeneView)
                Functional Consequence:
                utr variant 5 prime
                Validated:
                by 1000G,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                A=0.3409/1707
                HGVS:
                NC_000007.13:g.127881349G>A, NC_000007.14:g.128241296G>A, NG_007450.1:g.5019G>A, NM_000230.2:c.-39G>A, XM_005250340.1:c.-39G>A, XM_005250340.3:c.-39G>A
                10.

                rs2069849 [Homo sapiens]
                  TCATTCTGCGCAGCTTTAAGGAGTT[C/T]CTGCAGTCCAGCCTGAGGGCTCTTC
                  Chromosome:
                  7:22731537
                  Gene:
                  IL6 (GeneView)
                  Functional Consequence:
                  downstream variant 500B,synonymous codon
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.0701/351
                  HGVS:
                  NC_000007.13:g.22771156C>T, NC_000007.14:g.22731537C>T, NG_011640.1:g.9391C>T, NM_000600.4:c.603C>T, NM_001318095.1:c.375C>T, NP_000591.1:p.Phe201, NP_001305024.1:p.Phe125, XM_005249745.3:c.*1751C>T, XM_005249746.1:c.375C>T, XM_011515390.1:c.603C>T, XM_011515391.1:c.375C>T, XP_005249803.1:p.Phe125, XP_011513692.1:p.Phe201, XP_011513693.1:p.Phe125
                  11.

                  rs2069832 [Homo sapiens]
                    TATTTATCCTTTGCTGGTGTCAGGA[A/G]GTTCCTTTCCTTTCTGGAAAATGCA
                    Chromosome:
                    7:22727814
                    Gene:
                    IL6 (GeneView) LOC541472 (GeneView)
                    Functional Consequence:
                    intron variant,upstream variant 2KB
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.1396/699
                    HGVS:
                    NC_000007.13:g.22767433A>G, NC_000007.14:g.22727814A>G, NG_011640.1:g.5668A>G, NM_000600.4:c.210+180A>G, NM_001318095.1:c.-19+533A>G, NR_131935.1:n.-194T>C, XM_005249745.1:c.372+180A>G, XM_005249745.3:c.372+180A>G, XM_005249746.1:c.-19+533A>G, XM_011515390.1:c.210+180A>G, XM_011515391.1:c.-19+533A>G
                    12.

                    rs1887285 [Homo sapiens]
                      GAGAATAAAACTCATCTCCTACTTA[C/T]GAAGTCTTTCTTAAAGTGAACATGA
                      Chromosome:
                      1:65432064
                      Gene:
                      LEPR (GeneView) LEPROT (GeneView)
                      Functional Consequence:
                      intron variant,utr variant 3 prime
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      G=0.0683/342
                      HGVS:
                      NC_000001.10:g.65897747A>G, NC_000001.11:g.65432064A>G, NG_015831.2:g.16500A>G, NM_001003679.3:c.-21+6686A>G, NM_001003680.3:c.-21+6686A>G, NM_001198681.1:c.*145A>G, NM_002303.5:c.-21+6686A>G, NM_017526.4:c.*145A>G, XM_005270952.1:c.-21+6686A>G
                      13.

                      rs1800795 [Homo sapiens]
                        ACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA
                        Chromosome:
                        7:22727026
                        Gene:
                        IL6 (GeneView) LOC541472 (GeneView)
                        Functional Consequence:
                        intron variant,upstream variant 2KB
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        C=0.1412/707
                        HGVS:
                        NC_000007.13:g.22766645C>G, NC_000007.14:g.22727026C>G, NG_011640.1:g.4880C>G, NM_000600.4:c.-237C>G, NM_001318095.1:c.-274C>G, NR_131935.1:n.54-321G>C, XM_005249745.1:c.-237C>G, XM_005249745.3:c.-237C>G, XM_005249746.1:c.-274C>G, XM_011515390.1:c.-84-153C>G, XM_011515391.1:c.-274C>G
                        15.

                        rs1349419 [Homo sapiens]
                          TTTGGTCAACAGGAAACAGGATGTT[A/G]GCAGAGACTTGAAAAGTGCTTGCTC
                          Chromosome:
                          7:128237160
                          Gene:
                          LOC105375494 (GeneView)
                          Functional Consequence:
                          upstream variant 2KB
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.4479/2243
                          HGVS:
                          NC_000007.13:g.127877213A>G, NC_000007.14:g.128237160A>G, NG_007450.1:g.883A>G, XR_927945.1:n.-362T>C
                          17.

                          rs822393 [Homo sapiens]
                            AGCATGACACGGAGCTTCTCAGACT[C/T]AGCTTCCTAATCCGCTAAACGGGAT
                            Chromosome:
                            3:186848537
                            Gene:
                            ADIPOQ (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency
                            Global MAF:
                            T=0.3407/1706
                            HGVS:
                            NC_000003.11:g.186566326C>T, NC_000003.12:g.186848537C>T, NG_021140.1:g.10864C>T, NM_001177800.1:c.-9+2930C>T, NM_004797.3:c.-8-4514C>T, XM_011513324.1:c.-124-2569C>T
                            18.

                            rs791620 [Homo sapiens]
                              CCAAGGGTGCGCGCGTGGCTCCTGG[A/C]GCGCCGAGGCCCTCCCTCGAGGCCC
                              Chromosome:
                              7:128241090
                              Gene:
                              LEP (GeneView)
                              Functional Consequence:
                              upstream variant 2KB
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.0559/280
                              HGVS:
                              NC_000007.13:g.127881143C>A, NC_000007.14:g.128241090C>A, NG_007450.1:g.4813C>A, NM_000230.2:c.-245C>A, XM_005250340.1:c.-245C>A, XM_005250340.3:c.-245C>A
                              19.

                              rs182052 [Homo sapiens]
                                GATGCATGGAACCATTCTGAATTTT[A/G]CCCAGTTCGCTCTGTAGCAGGATAC
                                Chromosome:
                                3:186842993
                                Gene:
                                ADIPOQ (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                A=0.3924/1965
                                HGVS:
                                NC_000003.11:g.186560782G>A, NC_000003.12:g.186842993G>A, NG_021140.1:g.5320G>A, NM_001177800.1:c.-60+244G>A, NM_004797.3:c.-9+244G>A, XM_011513324.1:c.-125+244G>A
                                20.

                                rs7883 [Homo sapiens]
                                  CGGTGCTCTCAGAAAATATATTAAC[A/G]CAGTCTTGTAGGCAGCTGCCACCTT
                                  Chromosome:
                                  1:65432186
                                  Gene:
                                  LEPR (GeneView) LEPROT (GeneView)
                                  Functional Consequence:
                                  intron variant,utr variant 3 prime
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  A=0.1450/726
                                  HGVS:
                                  NC_000001.10:g.65897869G>A, NC_000001.11:g.65432186G>A, NG_015831.2:g.16622G>A, NM_001003679.3:c.-21+6808G>A, NM_001003680.3:c.-21+6808G>A, NM_001198681.1:c.*267G>A, NM_002303.5:c.-21+6808G>A, NM_017526.4:c.*267G>A, XM_005270952.1:c.-21+6808G>A

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Write to the Help Desk